ID: 1193286575

View in Genome Browser
Species Human (GRCh38)
Location X:79721903-79721925
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193286575_1193286584 17 Left 1193286575 X:79721903-79721925 CCACAGTGGCTCTACATCCCTTG No data
Right 1193286584 X:79721943-79721965 CCCTAATGGGTGGCTCATGGCGG No data
1193286575_1193286579 3 Left 1193286575 X:79721903-79721925 CCACAGTGGCTCTACATCCCTTG No data
Right 1193286579 X:79721929-79721951 GTTCTCTCAGCTCACCCTAATGG No data
1193286575_1193286582 14 Left 1193286575 X:79721903-79721925 CCACAGTGGCTCTACATCCCTTG No data
Right 1193286582 X:79721940-79721962 TCACCCTAATGGGTGGCTCATGG No data
1193286575_1193286586 25 Left 1193286575 X:79721903-79721925 CCACAGTGGCTCTACATCCCTTG No data
Right 1193286586 X:79721951-79721973 GGTGGCTCATGGCGGTGAGAAGG No data
1193286575_1193286580 4 Left 1193286575 X:79721903-79721925 CCACAGTGGCTCTACATCCCTTG No data
Right 1193286580 X:79721930-79721952 TTCTCTCAGCTCACCCTAATGGG No data
1193286575_1193286581 7 Left 1193286575 X:79721903-79721925 CCACAGTGGCTCTACATCCCTTG No data
Right 1193286581 X:79721933-79721955 TCTCAGCTCACCCTAATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193286575 Original CRISPR CAAGGGATGTAGAGCCACTG TGG (reversed) Intergenic