ID: 1193286577

View in Genome Browser
Species Human (GRCh38)
Location X:79721920-79721942
Sequence TGAGCTGAGAGAACAGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193286577_1193286584 0 Left 1193286577 X:79721920-79721942 CCCTTGGCTGTTCTCTCAGCTCA No data
Right 1193286584 X:79721943-79721965 CCCTAATGGGTGGCTCATGGCGG No data
1193286577_1193286586 8 Left 1193286577 X:79721920-79721942 CCCTTGGCTGTTCTCTCAGCTCA No data
Right 1193286586 X:79721951-79721973 GGTGGCTCATGGCGGTGAGAAGG No data
1193286577_1193286581 -10 Left 1193286577 X:79721920-79721942 CCCTTGGCTGTTCTCTCAGCTCA No data
Right 1193286581 X:79721933-79721955 TCTCAGCTCACCCTAATGGGTGG No data
1193286577_1193286587 15 Left 1193286577 X:79721920-79721942 CCCTTGGCTGTTCTCTCAGCTCA No data
Right 1193286587 X:79721958-79721980 CATGGCGGTGAGAAGGACCTTGG No data
1193286577_1193286582 -3 Left 1193286577 X:79721920-79721942 CCCTTGGCTGTTCTCTCAGCTCA No data
Right 1193286582 X:79721940-79721962 TCACCCTAATGGGTGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193286577 Original CRISPR TGAGCTGAGAGAACAGCCAA GGG (reversed) Intergenic