ID: 1193286578

View in Genome Browser
Species Human (GRCh38)
Location X:79721921-79721943
Sequence GTGAGCTGAGAGAACAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193286578_1193286582 -4 Left 1193286578 X:79721921-79721943 CCTTGGCTGTTCTCTCAGCTCAC No data
Right 1193286582 X:79721940-79721962 TCACCCTAATGGGTGGCTCATGG No data
1193286578_1193286584 -1 Left 1193286578 X:79721921-79721943 CCTTGGCTGTTCTCTCAGCTCAC No data
Right 1193286584 X:79721943-79721965 CCCTAATGGGTGGCTCATGGCGG No data
1193286578_1193286587 14 Left 1193286578 X:79721921-79721943 CCTTGGCTGTTCTCTCAGCTCAC No data
Right 1193286587 X:79721958-79721980 CATGGCGGTGAGAAGGACCTTGG No data
1193286578_1193286586 7 Left 1193286578 X:79721921-79721943 CCTTGGCTGTTCTCTCAGCTCAC No data
Right 1193286586 X:79721951-79721973 GGTGGCTCATGGCGGTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193286578 Original CRISPR GTGAGCTGAGAGAACAGCCA AGG (reversed) Intergenic