ID: 1193286582

View in Genome Browser
Species Human (GRCh38)
Location X:79721940-79721962
Sequence TCACCCTAATGGGTGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193286575_1193286582 14 Left 1193286575 X:79721903-79721925 CCACAGTGGCTCTACATCCCTTG No data
Right 1193286582 X:79721940-79721962 TCACCCTAATGGGTGGCTCATGG No data
1193286574_1193286582 22 Left 1193286574 X:79721895-79721917 CCTCTTGACCACAGTGGCTCTAC No data
Right 1193286582 X:79721940-79721962 TCACCCTAATGGGTGGCTCATGG No data
1193286578_1193286582 -4 Left 1193286578 X:79721921-79721943 CCTTGGCTGTTCTCTCAGCTCAC No data
Right 1193286582 X:79721940-79721962 TCACCCTAATGGGTGGCTCATGG No data
1193286577_1193286582 -3 Left 1193286577 X:79721920-79721942 CCCTTGGCTGTTCTCTCAGCTCA No data
Right 1193286582 X:79721940-79721962 TCACCCTAATGGGTGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193286582 Original CRISPR TCACCCTAATGGGTGGCTCA TGG Intergenic