ID: 1193286584

View in Genome Browser
Species Human (GRCh38)
Location X:79721943-79721965
Sequence CCCTAATGGGTGGCTCATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193286577_1193286584 0 Left 1193286577 X:79721920-79721942 CCCTTGGCTGTTCTCTCAGCTCA No data
Right 1193286584 X:79721943-79721965 CCCTAATGGGTGGCTCATGGCGG No data
1193286575_1193286584 17 Left 1193286575 X:79721903-79721925 CCACAGTGGCTCTACATCCCTTG No data
Right 1193286584 X:79721943-79721965 CCCTAATGGGTGGCTCATGGCGG No data
1193286574_1193286584 25 Left 1193286574 X:79721895-79721917 CCTCTTGACCACAGTGGCTCTAC No data
Right 1193286584 X:79721943-79721965 CCCTAATGGGTGGCTCATGGCGG No data
1193286578_1193286584 -1 Left 1193286578 X:79721921-79721943 CCTTGGCTGTTCTCTCAGCTCAC No data
Right 1193286584 X:79721943-79721965 CCCTAATGGGTGGCTCATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193286584 Original CRISPR CCCTAATGGGTGGCTCATGG CGG Intergenic