ID: 1193286586

View in Genome Browser
Species Human (GRCh38)
Location X:79721951-79721973
Sequence GGTGGCTCATGGCGGTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193286578_1193286586 7 Left 1193286578 X:79721921-79721943 CCTTGGCTGTTCTCTCAGCTCAC No data
Right 1193286586 X:79721951-79721973 GGTGGCTCATGGCGGTGAGAAGG No data
1193286575_1193286586 25 Left 1193286575 X:79721903-79721925 CCACAGTGGCTCTACATCCCTTG No data
Right 1193286586 X:79721951-79721973 GGTGGCTCATGGCGGTGAGAAGG No data
1193286577_1193286586 8 Left 1193286577 X:79721920-79721942 CCCTTGGCTGTTCTCTCAGCTCA No data
Right 1193286586 X:79721951-79721973 GGTGGCTCATGGCGGTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193286586 Original CRISPR GGTGGCTCATGGCGGTGAGA AGG Intergenic