ID: 1193286587

View in Genome Browser
Species Human (GRCh38)
Location X:79721958-79721980
Sequence CATGGCGGTGAGAAGGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193286583_1193286587 -8 Left 1193286583 X:79721943-79721965 CCCTAATGGGTGGCTCATGGCGG No data
Right 1193286587 X:79721958-79721980 CATGGCGGTGAGAAGGACCTTGG No data
1193286585_1193286587 -9 Left 1193286585 X:79721944-79721966 CCTAATGGGTGGCTCATGGCGGT No data
Right 1193286587 X:79721958-79721980 CATGGCGGTGAGAAGGACCTTGG No data
1193286577_1193286587 15 Left 1193286577 X:79721920-79721942 CCCTTGGCTGTTCTCTCAGCTCA No data
Right 1193286587 X:79721958-79721980 CATGGCGGTGAGAAGGACCTTGG No data
1193286578_1193286587 14 Left 1193286578 X:79721921-79721943 CCTTGGCTGTTCTCTCAGCTCAC No data
Right 1193286587 X:79721958-79721980 CATGGCGGTGAGAAGGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193286587 Original CRISPR CATGGCGGTGAGAAGGACCT TGG Intergenic