ID: 1193290149

View in Genome Browser
Species Human (GRCh38)
Location X:79762879-79762901
Sequence GAGTGCCCAAAGTATAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193290149_1193290154 14 Left 1193290149 X:79762879-79762901 CCCCTCTTATACTTTGGGCACTC No data
Right 1193290154 X:79762916-79762938 GTTTTAAGGAGCCTGCGCAGTGG No data
1193290149_1193290153 0 Left 1193290149 X:79762879-79762901 CCCCTCTTATACTTTGGGCACTC No data
Right 1193290153 X:79762902-79762924 ACAGTTTTTTGGCTGTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193290149 Original CRISPR GAGTGCCCAAAGTATAAGAG GGG (reversed) Intergenic
No off target data available for this crispr