ID: 1193290151

View in Genome Browser
Species Human (GRCh38)
Location X:79762881-79762903
Sequence GTGAGTGCCCAAAGTATAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193290151_1193290153 -2 Left 1193290151 X:79762881-79762903 CCTCTTATACTTTGGGCACTCAC No data
Right 1193290153 X:79762902-79762924 ACAGTTTTTTGGCTGTTTTAAGG No data
1193290151_1193290154 12 Left 1193290151 X:79762881-79762903 CCTCTTATACTTTGGGCACTCAC No data
Right 1193290154 X:79762916-79762938 GTTTTAAGGAGCCTGCGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193290151 Original CRISPR GTGAGTGCCCAAAGTATAAG AGG (reversed) Intergenic
No off target data available for this crispr