ID: 1193290153

View in Genome Browser
Species Human (GRCh38)
Location X:79762902-79762924
Sequence ACAGTTTTTTGGCTGTTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193290150_1193290153 -1 Left 1193290150 X:79762880-79762902 CCCTCTTATACTTTGGGCACTCA No data
Right 1193290153 X:79762902-79762924 ACAGTTTTTTGGCTGTTTTAAGG No data
1193290151_1193290153 -2 Left 1193290151 X:79762881-79762903 CCTCTTATACTTTGGGCACTCAC No data
Right 1193290153 X:79762902-79762924 ACAGTTTTTTGGCTGTTTTAAGG No data
1193290149_1193290153 0 Left 1193290149 X:79762879-79762901 CCCCTCTTATACTTTGGGCACTC No data
Right 1193290153 X:79762902-79762924 ACAGTTTTTTGGCTGTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193290153 Original CRISPR ACAGTTTTTTGGCTGTTTTA AGG Intergenic
No off target data available for this crispr