ID: 1193294582

View in Genome Browser
Species Human (GRCh38)
Location X:79819767-79819789
Sequence GAGTGGTTGGTTTGAATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193294582_1193294587 -3 Left 1193294582 X:79819767-79819789 CCCAGGATTCAAACCAACCACTC No data
Right 1193294587 X:79819787-79819809 CTCAACCAATCGATAAGTGAGGG No data
1193294582_1193294588 1 Left 1193294582 X:79819767-79819789 CCCAGGATTCAAACCAACCACTC No data
Right 1193294588 X:79819791-79819813 ACCAATCGATAAGTGAGGGTTGG No data
1193294582_1193294591 3 Left 1193294582 X:79819767-79819789 CCCAGGATTCAAACCAACCACTC No data
Right 1193294591 X:79819793-79819815 CAATCGATAAGTGAGGGTTGGGG No data
1193294582_1193294590 2 Left 1193294582 X:79819767-79819789 CCCAGGATTCAAACCAACCACTC No data
Right 1193294590 X:79819792-79819814 CCAATCGATAAGTGAGGGTTGGG No data
1193294582_1193294586 -4 Left 1193294582 X:79819767-79819789 CCCAGGATTCAAACCAACCACTC No data
Right 1193294586 X:79819786-79819808 ACTCAACCAATCGATAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193294582 Original CRISPR GAGTGGTTGGTTTGAATCCT GGG (reversed) Intergenic
No off target data available for this crispr