ID: 1193295496

View in Genome Browser
Species Human (GRCh38)
Location X:79827570-79827592
Sequence CTGCAAACAGCAGTGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193295491_1193295496 13 Left 1193295491 X:79827534-79827556 CCGGAGGGATGGAAGTCAGCGGC 0: 22
1: 88
2: 109
3: 75
4: 146
Right 1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG No data
1193295486_1193295496 24 Left 1193295486 X:79827523-79827545 CCCTGCCATATCCGGAGGGATGG No data
Right 1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG No data
1193295489_1193295496 19 Left 1193295489 X:79827528-79827550 CCATATCCGGAGGGATGGAAGTC No data
Right 1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG No data
1193295488_1193295496 23 Left 1193295488 X:79827524-79827546 CCTGCCATATCCGGAGGGATGGA No data
Right 1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193295496 Original CRISPR CTGCAAACAGCAGTGGTGGA AGG Intergenic
No off target data available for this crispr