ID: 1193296803

View in Genome Browser
Species Human (GRCh38)
Location X:79842927-79842949
Sequence TAAGCTTCTTAATATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193296803_1193296809 17 Left 1193296803 X:79842927-79842949 CCAGCAGCATATTAAGAAGCTTA No data
Right 1193296809 X:79842967-79842989 GGTTTCATCCCTGGGATGCAAGG 0: 204
1: 8665
2: 4998
3: 3881
4: 3397
1193296803_1193296808 9 Left 1193296803 X:79842927-79842949 CCAGCAGCATATTAAGAAGCTTA No data
Right 1193296808 X:79842959-79842981 ATCAATTTGGTTTCATCCCTGGG No data
1193296803_1193296807 8 Left 1193296803 X:79842927-79842949 CCAGCAGCATATTAAGAAGCTTA No data
Right 1193296807 X:79842958-79842980 GATCAATTTGGTTTCATCCCTGG No data
1193296803_1193296804 -4 Left 1193296803 X:79842927-79842949 CCAGCAGCATATTAAGAAGCTTA No data
Right 1193296804 X:79842946-79842968 CTTATCCACCACGATCAATTTGG 0: 8
1: 883
2: 8945
3: 3893
4: 2531
1193296803_1193296810 21 Left 1193296803 X:79842927-79842949 CCAGCAGCATATTAAGAAGCTTA No data
Right 1193296810 X:79842971-79842993 TCATCCCTGGGATGCAAGGCTGG 0: 8748
1: 4163
2: 2323
3: 2300
4: 3400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193296803 Original CRISPR TAAGCTTCTTAATATGCTGC TGG (reversed) Intergenic
No off target data available for this crispr