ID: 1193297777

View in Genome Browser
Species Human (GRCh38)
Location X:79852642-79852664
Sequence AGTTATGTGCAGATGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193297777_1193297785 25 Left 1193297777 X:79852642-79852664 CCTGCCATCATCTGCACATAACT No data
Right 1193297785 X:79852690-79852712 GGCCTGTTACTGGGGTTTGGTGG No data
1193297777_1193297783 17 Left 1193297777 X:79852642-79852664 CCTGCCATCATCTGCACATAACT No data
Right 1193297783 X:79852682-79852704 CAGTTCTTGGCCTGTTACTGGGG No data
1193297777_1193297784 22 Left 1193297777 X:79852642-79852664 CCTGCCATCATCTGCACATAACT No data
Right 1193297784 X:79852687-79852709 CTTGGCCTGTTACTGGGGTTTGG No data
1193297777_1193297781 15 Left 1193297777 X:79852642-79852664 CCTGCCATCATCTGCACATAACT No data
Right 1193297781 X:79852680-79852702 AACAGTTCTTGGCCTGTTACTGG No data
1193297777_1193297779 4 Left 1193297777 X:79852642-79852664 CCTGCCATCATCTGCACATAACT No data
Right 1193297779 X:79852669-79852691 TCCTTTTGAGAAACAGTTCTTGG No data
1193297777_1193297782 16 Left 1193297777 X:79852642-79852664 CCTGCCATCATCTGCACATAACT No data
Right 1193297782 X:79852681-79852703 ACAGTTCTTGGCCTGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193297777 Original CRISPR AGTTATGTGCAGATGATGGC AGG (reversed) Intergenic
No off target data available for this crispr