ID: 1193298077

View in Genome Browser
Species Human (GRCh38)
Location X:79855169-79855191
Sequence TTCGGCCTACTTTATATTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193298077_1193298080 -1 Left 1193298077 X:79855169-79855191 CCTAGAATATAAAGTAGGCCGAA No data
Right 1193298080 X:79855191-79855213 AAAACATGAAGAGGCTAGACTGG No data
1193298077_1193298078 -10 Left 1193298077 X:79855169-79855191 CCTAGAATATAAAGTAGGCCGAA No data
Right 1193298078 X:79855182-79855204 GTAGGCCGAAAAACATGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193298077 Original CRISPR TTCGGCCTACTTTATATTCT AGG (reversed) Intergenic
No off target data available for this crispr