ID: 1193300860

View in Genome Browser
Species Human (GRCh38)
Location X:79886862-79886884
Sequence GTGGAGGAACTCAGCCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193300860_1193300870 16 Left 1193300860 X:79886862-79886884 CCCTCCTGGCTGAGTTCCTCCAC No data
Right 1193300870 X:79886901-79886923 AGACCAAGGAAATAAATTTTGGG No data
1193300860_1193300871 17 Left 1193300860 X:79886862-79886884 CCCTCCTGGCTGAGTTCCTCCAC No data
Right 1193300871 X:79886902-79886924 GACCAAGGAAATAAATTTTGGGG No data
1193300860_1193300869 15 Left 1193300860 X:79886862-79886884 CCCTCCTGGCTGAGTTCCTCCAC No data
Right 1193300869 X:79886900-79886922 AAGACCAAGGAAATAAATTTTGG No data
1193300860_1193300868 2 Left 1193300860 X:79886862-79886884 CCCTCCTGGCTGAGTTCCTCCAC No data
Right 1193300868 X:79886887-79886909 AATCTGGTAGCTTAAGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193300860 Original CRISPR GTGGAGGAACTCAGCCAGGA GGG (reversed) Intergenic
No off target data available for this crispr