ID: 1193306698

View in Genome Browser
Species Human (GRCh38)
Location X:79959419-79959441
Sequence CTGTCGCCTGACTCTATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193306691_1193306698 28 Left 1193306691 X:79959368-79959390 CCTACTGCCTTTCTGGAGAGACT No data
Right 1193306698 X:79959419-79959441 CTGTCGCCTGACTCTATTGAAGG No data
1193306694_1193306698 21 Left 1193306694 X:79959375-79959397 CCTTTCTGGAGAGACTAAGGGAG 0: 64
1: 38
2: 15
3: 52
4: 340
Right 1193306698 X:79959419-79959441 CTGTCGCCTGACTCTATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193306698 Original CRISPR CTGTCGCCTGACTCTATTGA AGG Intergenic
No off target data available for this crispr