ID: 1193311890

View in Genome Browser
Species Human (GRCh38)
Location X:80020388-80020410
Sequence TTCGCACCCATTAAAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193311890_1193311895 11 Left 1193311890 X:80020388-80020410 CCCCCCACTTTAATGGGTGCGAA 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1193311895 X:80020422-80020444 GCTCAGATCACATGCAGATGTGG 0: 1
1: 0
2: 1
3: 23
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193311890 Original CRISPR TTCGCACCCATTAAAGTGGG GGG (reversed) Intronic
1073208797 10:101782396-101782418 TTAGCACTCATTACAGTGTGGGG - Intronic
1077266127 11:1651341-1651363 TTCACAACCATTTAAGTGTGAGG - Intergenic
1083306429 11:61764326-61764348 TGAGCACCCACTAAAGTGGCTGG + Intronic
1091176774 11:133565852-133565874 TTCAGAACCATTAAAATGGGAGG + Intergenic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1098828791 12:75333120-75333142 TTGGCTCACATTACAGTGGGGGG - Intronic
1101393116 12:104321302-104321324 TTCGTACCAATTAAAGTAAGTGG + Exonic
1101821602 12:108188486-108188508 TTTGCACCCCGTACAGTGGGTGG - Intronic
1108978993 13:56486147-56486169 TTAGCATCCATTAAACTGGCAGG + Intergenic
1113946890 13:114049333-114049355 TTCGCAGCTATGAAAATGGGTGG - Intronic
1117602416 14:57389921-57389943 CTCGCACCCAGTAAAATTGGAGG - Intergenic
1121180601 14:91925907-91925929 TTGACACCCAGTACAGTGGGAGG + Intronic
1130075558 15:80686156-80686178 TTCACCCTCATTAATGTGGGAGG - Intronic
1133770537 16:8864998-8865020 TTGGCTCCCATTGATGTGGGTGG - Intronic
1139786424 16:69396457-69396479 TTCTCATCCATTAAATTGAGGGG + Intronic
925058558 2:873745-873767 GAAGCACCCATGAAAGTGGGAGG + Intergenic
925737238 2:6974115-6974137 TTCGCAGCCTGTAAAGTGGGAGG + Intronic
928111487 2:28513421-28513443 TTGGCACCCATTGAGGAGGGGGG - Intronic
928203814 2:29269804-29269826 TTAGCACCCATTCAGCTGGGGGG - Intronic
933106314 2:78330385-78330407 TGACCACCCATCAAAGTGGGTGG - Intergenic
935722382 2:105990860-105990882 TTCTCACCCATTAAGGGGAGAGG - Intergenic
941301842 2:163812170-163812192 TTAGCAGCCATTACAGTGTGTGG - Intergenic
942366511 2:175233952-175233974 TACGCAACAATTAAAGTGTGCGG - Intergenic
1176011128 20:62896489-62896511 TTCTTACCCATTAAAATGGAAGG - Intronic
1178605922 21:34036534-34036556 TTAGCACCCAGCAAGGTGGGTGG + Intergenic
1181381236 22:22506331-22506353 TTCACAGCCATTCAGGTGGGAGG + Intronic
954317574 3:49809534-49809556 TTCCCACCTAATAAAGTGTGTGG - Exonic
956604835 3:71064194-71064216 TTCACACACAGTAAAGGGGGAGG - Intronic
973900656 4:55466706-55466728 TTGACACCTATTAAAGTGGCAGG - Intronic
986430596 5:7677341-7677363 TTTGGAACCATTAATGTGGGAGG + Intronic
986600431 5:9467472-9467494 TTCTCACCCATGGAAGTGGAAGG - Intronic
992929077 5:81622375-81622397 TTCCCACCTATAAAAGTGGAAGG + Intronic
1013139965 6:107322982-107323004 TTCTCACTCCTGAAAGTGGGTGG - Intronic
1015881663 6:137876031-137876053 TTCGCCCCTTTGAAAGTGGGTGG + Exonic
1026451783 7:70535840-70535862 TTCCCACCCAATAAAGAGGATGG + Intronic
1032409334 7:131683008-131683030 TTCTCACCCATGTATGTGGGGGG - Intergenic
1032485504 7:132284411-132284433 TTCACTCTCATTAAAGTGTGGGG - Intronic
1033167094 7:139049269-139049291 CTCGCACCGATTAGAATGGGAGG - Intronic
1037442654 8:18932296-18932318 TTTGCATTCAGTAAAGTGGGAGG + Intronic
1044268509 8:90211695-90211717 TTCGTTCCCATGAAAGTGGGTGG - Intergenic
1044477025 8:92639040-92639062 TTTGAACCGATTAAAGTGTGTGG - Intergenic
1047452487 8:124977983-124978005 TTCCCATCCTTTAAACTGGGAGG - Exonic
1061984633 9:134123243-134123265 TACCCACCTATTAGAGTGGGAGG + Intergenic
1193311890 X:80020388-80020410 TTCGCACCCATTAAAGTGGGGGG - Intronic
1196172286 X:112602647-112602669 GTTGCACACAGTAAAGTGGGTGG + Intergenic
1199908012 X:152254832-152254854 TTAGCACTCATTAATGTGGAAGG + Intronic