ID: 1193316525

View in Genome Browser
Species Human (GRCh38)
Location X:80071822-80071844
Sequence CCTAGATTTCAGAGGATGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193316525_1193316533 27 Left 1193316525 X:80071822-80071844 CCATACATCCTCTGAAATCTAGG No data
Right 1193316533 X:80071872-80071894 TGTCCCCCTTTAGTCACAGTTGG No data
1193316525_1193316534 28 Left 1193316525 X:80071822-80071844 CCATACATCCTCTGAAATCTAGG No data
Right 1193316534 X:80071873-80071895 GTCCCCCTTTAGTCACAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193316525 Original CRISPR CCTAGATTTCAGAGGATGTA TGG (reversed) Intergenic