ID: 1193316528

View in Genome Browser
Species Human (GRCh38)
Location X:80071830-80071852
Sequence ATCCTCTGCCTAGATTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193316528_1193316539 27 Left 1193316528 X:80071830-80071852 CCTCTGAAATCTAGGCAGAGGAT No data
Right 1193316539 X:80071880-80071902 TTTAGTCACAGTTGGGACACAGG No data
1193316528_1193316533 19 Left 1193316528 X:80071830-80071852 CCTCTGAAATCTAGGCAGAGGAT No data
Right 1193316533 X:80071872-80071894 TGTCCCCCTTTAGTCACAGTTGG No data
1193316528_1193316540 28 Left 1193316528 X:80071830-80071852 CCTCTGAAATCTAGGCAGAGGAT No data
Right 1193316540 X:80071881-80071903 TTAGTCACAGTTGGGACACAGGG No data
1193316528_1193316534 20 Left 1193316528 X:80071830-80071852 CCTCTGAAATCTAGGCAGAGGAT No data
Right 1193316534 X:80071873-80071895 GTCCCCCTTTAGTCACAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193316528 Original CRISPR ATCCTCTGCCTAGATTTCAG AGG (reversed) Intergenic