ID: 1193316529

View in Genome Browser
Species Human (GRCh38)
Location X:80071855-80071877
Sequence GGGACAACTGTGACTAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193316529_1193316541 6 Left 1193316529 X:80071855-80071877 CCCCCTTTAGTCACAGTTGTCCC No data
Right 1193316541 X:80071884-80071906 GTCACAGTTGGGACACAGGGTGG No data
1193316529_1193316539 2 Left 1193316529 X:80071855-80071877 CCCCCTTTAGTCACAGTTGTCCC No data
Right 1193316539 X:80071880-80071902 TTTAGTCACAGTTGGGACACAGG No data
1193316529_1193316540 3 Left 1193316529 X:80071855-80071877 CCCCCTTTAGTCACAGTTGTCCC No data
Right 1193316540 X:80071881-80071903 TTAGTCACAGTTGGGACACAGGG No data
1193316529_1193316534 -5 Left 1193316529 X:80071855-80071877 CCCCCTTTAGTCACAGTTGTCCC No data
Right 1193316534 X:80071873-80071895 GTCCCCCTTTAGTCACAGTTGGG No data
1193316529_1193316543 18 Left 1193316529 X:80071855-80071877 CCCCCTTTAGTCACAGTTGTCCC No data
Right 1193316543 X:80071896-80071918 ACACAGGGTGGCAAGTCTGGAGG No data
1193316529_1193316533 -6 Left 1193316529 X:80071855-80071877 CCCCCTTTAGTCACAGTTGTCCC No data
Right 1193316533 X:80071872-80071894 TGTCCCCCTTTAGTCACAGTTGG No data
1193316529_1193316542 15 Left 1193316529 X:80071855-80071877 CCCCCTTTAGTCACAGTTGTCCC No data
Right 1193316542 X:80071893-80071915 GGGACACAGGGTGGCAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193316529 Original CRISPR GGGACAACTGTGACTAAAGG GGG (reversed) Intergenic