ID: 1193316530

View in Genome Browser
Species Human (GRCh38)
Location X:80071856-80071878
Sequence GGGGACAACTGTGACTAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193316530_1193316533 -7 Left 1193316530 X:80071856-80071878 CCCCTTTAGTCACAGTTGTCCCC No data
Right 1193316533 X:80071872-80071894 TGTCCCCCTTTAGTCACAGTTGG No data
1193316530_1193316539 1 Left 1193316530 X:80071856-80071878 CCCCTTTAGTCACAGTTGTCCCC No data
Right 1193316539 X:80071880-80071902 TTTAGTCACAGTTGGGACACAGG No data
1193316530_1193316540 2 Left 1193316530 X:80071856-80071878 CCCCTTTAGTCACAGTTGTCCCC No data
Right 1193316540 X:80071881-80071903 TTAGTCACAGTTGGGACACAGGG No data
1193316530_1193316542 14 Left 1193316530 X:80071856-80071878 CCCCTTTAGTCACAGTTGTCCCC No data
Right 1193316542 X:80071893-80071915 GGGACACAGGGTGGCAAGTCTGG No data
1193316530_1193316534 -6 Left 1193316530 X:80071856-80071878 CCCCTTTAGTCACAGTTGTCCCC No data
Right 1193316534 X:80071873-80071895 GTCCCCCTTTAGTCACAGTTGGG No data
1193316530_1193316541 5 Left 1193316530 X:80071856-80071878 CCCCTTTAGTCACAGTTGTCCCC No data
Right 1193316541 X:80071884-80071906 GTCACAGTTGGGACACAGGGTGG No data
1193316530_1193316543 17 Left 1193316530 X:80071856-80071878 CCCCTTTAGTCACAGTTGTCCCC No data
Right 1193316543 X:80071896-80071918 ACACAGGGTGGCAAGTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193316530 Original CRISPR GGGGACAACTGTGACTAAAG GGG (reversed) Intergenic