ID: 1193316534

View in Genome Browser
Species Human (GRCh38)
Location X:80071873-80071895
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193316531_1193316534 -7 Left 1193316531 X:80071857-80071879 CCCTTTAGTCACAGTTGTCCCCC No data
Right 1193316534 X:80071873-80071895 GTCCCCCTTTAGTCACAGTTGGG No data
1193316532_1193316534 -8 Left 1193316532 X:80071858-80071880 CCTTTAGTCACAGTTGTCCCCCT No data
Right 1193316534 X:80071873-80071895 GTCCCCCTTTAGTCACAGTTGGG No data
1193316525_1193316534 28 Left 1193316525 X:80071822-80071844 CCATACATCCTCTGAAATCTAGG 0: 1213
1: 2115
2: 1582
3: 880
4: 453
Right 1193316534 X:80071873-80071895 GTCCCCCTTTAGTCACAGTTGGG No data
1193316528_1193316534 20 Left 1193316528 X:80071830-80071852 CCTCTGAAATCTAGGCAGAGGAT 0: 12
1: 758
2: 1048
3: 1352
4: 1433
Right 1193316534 X:80071873-80071895 GTCCCCCTTTAGTCACAGTTGGG No data
1193316530_1193316534 -6 Left 1193316530 X:80071856-80071878 CCCCTTTAGTCACAGTTGTCCCC No data
Right 1193316534 X:80071873-80071895 GTCCCCCTTTAGTCACAGTTGGG No data
1193316529_1193316534 -5 Left 1193316529 X:80071855-80071877 CCCCCTTTAGTCACAGTTGTCCC No data
Right 1193316534 X:80071873-80071895 GTCCCCCTTTAGTCACAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193316534 Original CRISPR GTCCCCCTTTAGTCACAGTT GGG Intergenic
No off target data available for this crispr