ID: 1193317626

View in Genome Browser
Species Human (GRCh38)
Location X:80082145-80082167
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193317623_1193317626 16 Left 1193317623 X:80082106-80082128 CCTGGACACAAACAGAGAAGTAG No data
Right 1193317626 X:80082145-80082167 TTAGAGTCCTAGAAATATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193317626 Original CRISPR TTAGAGTCCTAGAAATATGT TGG Intergenic
No off target data available for this crispr