ID: 1193317724

View in Genome Browser
Species Human (GRCh38)
Location X:80083183-80083205
Sequence TAGATTTAGCATTATGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193317724_1193317730 -10 Left 1193317724 X:80083183-80083205 CCCAGCCCATAATGCTAAATCTA No data
Right 1193317730 X:80083196-80083218 GCTAAATCTATGTTCTTCAGGGG No data
1193317724_1193317731 16 Left 1193317724 X:80083183-80083205 CCCAGCCCATAATGCTAAATCTA No data
Right 1193317731 X:80083222-80083244 GACTCACCTTCCACCCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193317724 Original CRISPR TAGATTTAGCATTATGGGCT GGG (reversed) Intergenic
No off target data available for this crispr