ID: 1193317730

View in Genome Browser
Species Human (GRCh38)
Location X:80083196-80083218
Sequence GCTAAATCTATGTTCTTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193317721_1193317730 25 Left 1193317721 X:80083148-80083170 CCCAAAGGCTGAGATTACAGGTG 0: 3
1: 500
2: 10843
3: 102617
4: 275456
Right 1193317730 X:80083196-80083218 GCTAAATCTATGTTCTTCAGGGG No data
1193317719_1193317730 28 Left 1193317719 X:80083145-80083167 CCTCCCAAAGGCTGAGATTACAG 0: 10
1: 146
2: 839
3: 2911
4: 8240
Right 1193317730 X:80083196-80083218 GCTAAATCTATGTTCTTCAGGGG No data
1193317723_1193317730 -2 Left 1193317723 X:80083175-80083197 CCTCTGCTCCCAGCCCATAATGC No data
Right 1193317730 X:80083196-80083218 GCTAAATCTATGTTCTTCAGGGG No data
1193317722_1193317730 24 Left 1193317722 X:80083149-80083171 CCAAAGGCTGAGATTACAGGTGT No data
Right 1193317730 X:80083196-80083218 GCTAAATCTATGTTCTTCAGGGG No data
1193317724_1193317730 -10 Left 1193317724 X:80083183-80083205 CCCAGCCCATAATGCTAAATCTA No data
Right 1193317730 X:80083196-80083218 GCTAAATCTATGTTCTTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193317730 Original CRISPR GCTAAATCTATGTTCTTCAG GGG Intergenic
No off target data available for this crispr