ID: 1193317731

View in Genome Browser
Species Human (GRCh38)
Location X:80083222-80083244
Sequence GACTCACCTTCCACCCATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193317725_1193317731 15 Left 1193317725 X:80083184-80083206 CCAGCCCATAATGCTAAATCTAT No data
Right 1193317731 X:80083222-80083244 GACTCACCTTCCACCCATTGAGG No data
1193317724_1193317731 16 Left 1193317724 X:80083183-80083205 CCCAGCCCATAATGCTAAATCTA No data
Right 1193317731 X:80083222-80083244 GACTCACCTTCCACCCATTGAGG No data
1193317726_1193317731 11 Left 1193317726 X:80083188-80083210 CCCATAATGCTAAATCTATGTTC No data
Right 1193317731 X:80083222-80083244 GACTCACCTTCCACCCATTGAGG No data
1193317723_1193317731 24 Left 1193317723 X:80083175-80083197 CCTCTGCTCCCAGCCCATAATGC No data
Right 1193317731 X:80083222-80083244 GACTCACCTTCCACCCATTGAGG No data
1193317727_1193317731 10 Left 1193317727 X:80083189-80083211 CCATAATGCTAAATCTATGTTCT No data
Right 1193317731 X:80083222-80083244 GACTCACCTTCCACCCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193317731 Original CRISPR GACTCACCTTCCACCCATTG AGG Intergenic
No off target data available for this crispr