ID: 1193328366

View in Genome Browser
Species Human (GRCh38)
Location X:80207914-80207936
Sequence GCTTCTGTTGCCCCACAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193328366_1193328369 24 Left 1193328366 X:80207914-80207936 CCTCTTTGTGGGGCAACAGAAGC No data
Right 1193328369 X:80207961-80207983 AAAGCCTGTGAGGTTTCATGTGG No data
1193328366_1193328370 25 Left 1193328366 X:80207914-80207936 CCTCTTTGTGGGGCAACAGAAGC No data
Right 1193328370 X:80207962-80207984 AAGCCTGTGAGGTTTCATGTGGG No data
1193328366_1193328368 14 Left 1193328366 X:80207914-80207936 CCTCTTTGTGGGGCAACAGAAGC No data
Right 1193328368 X:80207951-80207973 TTAGAGATCAAAAGCCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193328366 Original CRISPR GCTTCTGTTGCCCCACAAAG AGG (reversed) Intergenic
No off target data available for this crispr