ID: 1193331353

View in Genome Browser
Species Human (GRCh38)
Location X:80238615-80238637
Sequence TGCGTTGCAAGGGAAGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193331353_1193331356 -4 Left 1193331353 X:80238615-80238637 CCTGATTCTTCCCTTGCAACGCA No data
Right 1193331356 X:80238634-80238656 CGCACTATCCACATGTGCAGTGG No data
1193331353_1193331364 24 Left 1193331353 X:80238615-80238637 CCTGATTCTTCCCTTGCAACGCA No data
Right 1193331364 X:80238662-80238684 TCACATTTGGGAGGGGCCACAGG No data
1193331353_1193331360 15 Left 1193331353 X:80238615-80238637 CCTGATTCTTCCCTTGCAACGCA No data
Right 1193331360 X:80238653-80238675 GTGGCCTGCTCACATTTGGGAGG No data
1193331353_1193331359 12 Left 1193331353 X:80238615-80238637 CCTGATTCTTCCCTTGCAACGCA No data
Right 1193331359 X:80238650-80238672 GCAGTGGCCTGCTCACATTTGGG No data
1193331353_1193331358 11 Left 1193331353 X:80238615-80238637 CCTGATTCTTCCCTTGCAACGCA No data
Right 1193331358 X:80238649-80238671 TGCAGTGGCCTGCTCACATTTGG No data
1193331353_1193331361 16 Left 1193331353 X:80238615-80238637 CCTGATTCTTCCCTTGCAACGCA No data
Right 1193331361 X:80238654-80238676 TGGCCTGCTCACATTTGGGAGGG No data
1193331353_1193331362 17 Left 1193331353 X:80238615-80238637 CCTGATTCTTCCCTTGCAACGCA No data
Right 1193331362 X:80238655-80238677 GGCCTGCTCACATTTGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193331353 Original CRISPR TGCGTTGCAAGGGAAGAATC AGG (reversed) Intergenic
No off target data available for this crispr