ID: 1193336815

View in Genome Browser
Species Human (GRCh38)
Location X:80299351-80299373
Sequence ATATTTAATGGGATTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193336815_1193336821 -5 Left 1193336815 X:80299351-80299373 CCATCCCCAATCCCATTAAATAT No data
Right 1193336821 X:80299369-80299391 AATATTGATGTTTATCATATAGG No data
1193336815_1193336822 9 Left 1193336815 X:80299351-80299373 CCATCCCCAATCCCATTAAATAT No data
Right 1193336822 X:80299383-80299405 TCATATAGGCTTTTTCAACCTGG No data
1193336815_1193336823 14 Left 1193336815 X:80299351-80299373 CCATCCCCAATCCCATTAAATAT No data
Right 1193336823 X:80299388-80299410 TAGGCTTTTTCAACCTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193336815 Original CRISPR ATATTTAATGGGATTGGGGA TGG (reversed) Intergenic
No off target data available for this crispr