ID: 1193337974

View in Genome Browser
Species Human (GRCh38)
Location X:80313086-80313108
Sequence CAGACACTAATTCAGCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 2, 1: 4, 2: 5, 3: 17, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193337968_1193337974 10 Left 1193337968 X:80313053-80313075 CCCTTTGCCGATTCCAACCAGAA No data
Right 1193337974 X:80313086-80313108 CAGACACTAATTCAGCTGACTGG 0: 2
1: 4
2: 5
3: 17
4: 113
1193337972_1193337974 -7 Left 1193337972 X:80313070-80313092 CCAGAACATCCAACAGCAGACAC No data
Right 1193337974 X:80313086-80313108 CAGACACTAATTCAGCTGACTGG 0: 2
1: 4
2: 5
3: 17
4: 113
1193337971_1193337974 -3 Left 1193337971 X:80313066-80313088 CCAACCAGAACATCCAACAGCAG No data
Right 1193337974 X:80313086-80313108 CAGACACTAATTCAGCTGACTGG 0: 2
1: 4
2: 5
3: 17
4: 113
1193337970_1193337974 3 Left 1193337970 X:80313060-80313082 CCGATTCCAACCAGAACATCCAA No data
Right 1193337974 X:80313086-80313108 CAGACACTAATTCAGCTGACTGG 0: 2
1: 4
2: 5
3: 17
4: 113
1193337969_1193337974 9 Left 1193337969 X:80313054-80313076 CCTTTGCCGATTCCAACCAGAAC No data
Right 1193337974 X:80313086-80313108 CAGACACTAATTCAGCTGACTGG 0: 2
1: 4
2: 5
3: 17
4: 113
1193337967_1193337974 23 Left 1193337967 X:80313040-80313062 CCAGTCTGGGAGGCCCTTTGCCG No data
Right 1193337974 X:80313086-80313108 CAGACACTAATTCAGCTGACTGG 0: 2
1: 4
2: 5
3: 17
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193337974 Original CRISPR CAGACACTAATTCAGCTGAC TGG Intergenic
901433091 1:9230004-9230026 CAGACACTAGTTCAGGTATCGGG - Intergenic
903476717 1:23624574-23624596 CAGGCACTGACTCAGCTGAGGGG + Intronic
903836235 1:26204854-26204876 CAGACACCAATTCTGATGACAGG + Intergenic
904314108 1:29649276-29649298 AAGACATTCATTGAGCTGACAGG + Intergenic
906729635 1:48070130-48070152 CAGTAAATAATTCAGATGACTGG + Intergenic
911809269 1:102253181-102253203 CAGAAACTACTTCAGCTGCTGGG + Intergenic
913502956 1:119488706-119488728 CAGACACTAATCCAGCTGACTGG - Intergenic
916287300 1:163122386-163122408 CAGACACTAATTGGCCTCACTGG + Intronic
918765702 1:188480229-188480251 CAGGCAGTAAATCAGCTGAGTGG + Intergenic
923480897 1:234382516-234382538 CACACACAAAGTCAGCTGAAAGG - Intronic
1062774315 10:133048-133070 CACACATTCATTCAGCTGAGGGG + Intergenic
1068557782 10:58478101-58478123 CAGACACCAATTCAGCTTCAGGG - Intergenic
1070747142 10:78940918-78940940 CAGACACTCATTCAACAGATAGG - Intergenic
1071702456 10:87954618-87954640 CTGAGACTATTTCACCTGACTGG - Intronic
1073449270 10:103600132-103600154 CAGCCACCGATTCAGCTGCCAGG - Exonic
1074164477 10:110862877-110862899 CAAACACAAAGGCAGCTGACTGG - Intergenic
1075198465 10:120381003-120381025 AAGAAACTAATTTTGCTGACTGG - Intergenic
1076209801 10:128631233-128631255 CATACATGAATTCAGCTGTCTGG - Intergenic
1078653144 11:13214643-13214665 CAGACACTAATTCAGCGTGATGG + Intergenic
1079426841 11:20351691-20351713 CAGGCACTAATCCAGGTGGCAGG + Intergenic
1079892957 11:26080599-26080621 CGGGCACTAATTCTGCAGACAGG + Intergenic
1082018100 11:47507622-47507644 CAGACAGAAATACAGCTGGCAGG - Intronic
1094265809 12:28558338-28558360 CAGACAGGAATTCAGCAGACTGG - Intronic
1096069778 12:48768561-48768583 CAGCCACAAATTCAGCTGAAGGG - Exonic
1100496437 12:95129439-95129461 CAGAGACTCAGTCAACTGACAGG - Intronic
1100724848 12:97397509-97397531 CAGAGATTAATTCAGCTGGCTGG - Intergenic
1100800450 12:98225117-98225139 CACACACTAATACAGCTGCGGGG + Intergenic
1102618005 12:114171661-114171683 CAGGCACAACTTCAGCTCACTGG - Intergenic
1104523029 12:129492989-129493011 CTGAGAATAATTAAGCTGACAGG + Intronic
1109474957 13:62868142-62868164 CAAACACTACTTCAGCTAAGTGG + Intergenic
1109926883 13:69153712-69153734 AAGACTCTAAGTCAGCAGACAGG + Intergenic
1110274413 13:73627759-73627781 CTGCCACCAATCCAGCTGACTGG + Intergenic
1111679879 13:91429268-91429290 CATAGACTAATACAGATGACTGG + Intronic
1113898820 13:113784422-113784444 CAGACACAAATCCAGCTGACTGG - Intronic
1115049354 14:29038042-29038064 CAGACACTAATTTTGCTGCCAGG + Intergenic
1115516125 14:34186955-34186977 CAGACACAAATTCACCTGCTTGG + Intronic
1116394315 14:44429863-44429885 CGGACACTAATCCAGCTGACTGG + Intergenic
1117479822 14:56131604-56131626 AAGACAATAATTCAACTGAAGGG - Intronic
1119752887 14:77092930-77092952 CAGTCACTACCTCAGGTGACTGG + Intergenic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1121091159 14:91183801-91183823 GAGATTCTAATTTAGCTGACAGG - Intronic
1121650307 14:95553242-95553264 CAGACCCTAATACAGGTAACAGG + Intergenic
1124533270 15:30524004-30524026 CTCACACTCATTCAGCAGACTGG - Intergenic
1124765387 15:32483640-32483662 CTCACACTCATTCAGCGGACTGG + Intergenic
1131347291 15:91662269-91662291 CTGATAATAATTCAGATGACAGG - Intergenic
1140638736 16:76947016-76947038 CAGGCACTGATTCTGATGACAGG + Intergenic
1142511079 17:393763-393785 CAGACACTACTTTAGGTGATGGG + Intergenic
1148213217 17:45820467-45820489 CAGGCATCAATTCAGCTCACAGG + Intronic
1148633362 17:49129081-49129103 CAGACACTAATCCAGCTAACTGG - Intergenic
1152399801 17:80059069-80059091 CAGTCACTCATCCAGCAGACGGG - Intronic
1155630745 18:27889073-27889095 CAGACACTAGTTTAGCTGTTGGG - Intergenic
1155644923 18:28065547-28065569 CAGACACTAACTCAAGTGCCAGG + Intronic
1156332463 18:36136308-36136330 CAGAAACTAATTCAGTAGAAGGG - Exonic
1158044658 18:53141607-53141629 GAAACACTATTTCAGCTGACTGG + Intronic
1158863983 18:61619672-61619694 CAGACACTAATCCAGCTGACTGG + Intergenic
1162667885 19:12230459-12230481 CAGACACTAATCCAGCTGACTGG - Intronic
1163661722 19:18582067-18582089 CAGACATTAAAACAGTTGACAGG + Intronic
1163980681 19:20896865-20896887 CACACACTCATTCAGCAGAGTGG + Intergenic
1166563717 19:43750505-43750527 CAGGCACTAATCCAGATGCCGGG - Intronic
1168032007 19:53687817-53687839 TAGACACTAATTCAGGAGGCTGG - Intergenic
925062501 2:904278-904300 CAGAAACCAAATCAGCTGCCTGG - Intergenic
926303664 2:11621706-11621728 CAGACACTGGTGCAGCTGGCTGG - Intronic
927899663 2:26810315-26810337 CAGGCACACATTCAGCTGTCAGG - Intergenic
930919341 2:56732906-56732928 CAGAGACGTATTCAACTGACTGG + Intergenic
935336524 2:102021944-102021966 CAAACACACATTCCGCTGACAGG - Intronic
937909940 2:127070610-127070632 CAGACACTCATTCAGCTTCTTGG + Exonic
938698623 2:133856986-133857008 CAGACATGAAATCAGCTGAAGGG + Intergenic
941242900 2:163063140-163063162 CAGATACTAATTCAGTAGATTGG - Intergenic
948814955 2:240505771-240505793 CAGACCTGAAATCAGCTGACTGG - Intronic
1170116728 20:12868423-12868445 CTGACACTGATTTAGATGACTGG + Intergenic
1170631925 20:18073288-18073310 CTGACATTGAGTCAGCTGACTGG - Intergenic
1173667059 20:44770600-44770622 CAGAGACTAAGTCAGCAGCCTGG + Intronic
1176837454 21:13806824-13806846 GAAACACTAATTTCGCTGACTGG - Intergenic
1177758016 21:25370622-25370644 CAGAAGCTAATTCATCTGACAGG - Intergenic
1178831943 21:36063548-36063570 CGGACACTAATCCAGCCAACTGG + Intronic
1179401805 21:41091134-41091156 CGGGCAATAATTCAGCTGAGAGG + Intergenic
1179994961 21:44969935-44969957 CAGACAGATCTTCAGCTGACAGG - Intronic
1180619764 22:17153266-17153288 CAGGCACTAAATTACCTGACTGG + Intronic
949131784 3:511437-511459 CAGATTCTTATTCAGCTGTCAGG - Intergenic
952969403 3:38641434-38641456 CCGAGGCTAATTCAGCTGACAGG + Intronic
955100610 3:55845775-55845797 AAGACAATAACTCAGCTCACAGG + Intronic
956095715 3:65713832-65713854 CAGGCACTAATTTAGCTGCTGGG + Intronic
959270766 3:104207129-104207151 CAGGCACTAATCCAAGTGACGGG - Intergenic
960823932 3:121762549-121762571 CAGATTTTAATTCAGCTGACAGG + Intergenic
965507126 3:169529133-169529155 CAGACACCACTTCAGCTGCTGGG + Intronic
967589206 3:191252899-191252921 CACACAGTAATACAGCTGAGAGG + Intronic
969136649 4:5034707-5034729 CCCACACTCATTCAGCTGATGGG + Intergenic
969374486 4:6754189-6754211 CAGAGGCTAAGCCAGCTGACCGG + Intergenic
971909142 4:32772259-32772281 CAGACACTAATTATGAGGACAGG - Intergenic
972295443 4:37733545-37733567 GAGAGATTAATTCAGCTGTCGGG - Intergenic
972662485 4:41129719-41129741 CAGACACTAGTCTAGGTGACAGG + Intronic
975589932 4:75990000-75990022 CAGACACTCATTTATCAGACGGG - Intronic
976953549 4:90865560-90865582 CACACACTAATTCAGGCAACTGG + Intronic
980349731 4:131669603-131669625 CAGACACTAAGGCACCTGAGAGG - Intergenic
986103292 5:4633767-4633789 TAGACACGACTACAGCTGACCGG - Intergenic
986872666 5:12068375-12068397 CAGACACTGACTCTGCTTACAGG - Intergenic
988954453 5:36300706-36300728 CTGACACTAACTCAGCTGGCTGG + Intronic
991323099 5:65398426-65398448 CAGAAATTAATACAGCTGGCCGG + Intronic
993334539 5:86641886-86641908 CAGACACATATACAGCTGAACGG + Intergenic
993529795 5:89010166-89010188 CAAACACAAATTCAACTGAAGGG + Intergenic
994192178 5:96880926-96880948 TTGAAACTAATTCAGTTGACTGG + Intronic
994816141 5:104591033-104591055 TGGACACTAATCCAGCTGCCTGG + Intergenic
997093276 5:130882034-130882056 CAGACACTAATTTAGGTGCTGGG + Intergenic
1002857694 6:1052630-1052652 CTGACACTAGTTCATCTCACTGG + Intergenic
1010771224 6:79833372-79833394 CAGACCCAAATGCAGATGACAGG - Intergenic
1013903199 6:115182178-115182200 CAGAGCCTAATTCAGCTTAAGGG - Intergenic
1014282166 6:119453599-119453621 GAGACACACATTCAGCTGGCAGG + Intergenic
1017888478 6:158620412-158620434 CAGACACTAATTCAGCTGACTGG - Intronic
1021405565 7:20263338-20263360 GAGACACTAATTTTGCTGCCAGG - Intergenic
1022881221 7:34589486-34589508 CATACACTAATAGAGCTGAGAGG - Intergenic
1028108771 7:86913139-86913161 CAGCCACTAATGCAGTTGATGGG - Exonic
1032875811 7:136037155-136037177 CAGAAGCTGATACAGCTGACAGG - Intergenic
1033890222 7:146003317-146003339 CGGACACTAAATGAGATGACAGG - Intergenic
1034030186 7:147753317-147753339 CACAAACTAATTCAGCTGCATGG - Intronic
1037531035 8:19774002-19774024 CAGAAACTAATACAACTGAAAGG + Intergenic
1039597849 8:38806909-38806931 CAGACACAAGTGCAGATGACTGG - Intronic
1040751743 8:50717955-50717977 CAGACATTAACTCTGCTGACTGG - Intronic
1047082430 8:121478089-121478111 CAGACACTAACTCAGTTCCCTGG - Intergenic
1047630099 8:126697511-126697533 CAGGCACAAATACAGATGACAGG - Intergenic
1050923476 9:11234679-11234701 TGGACACTAATCCAGCTGACTGG - Intergenic
1051518491 9:17957711-17957733 CAGACCCTAAATCTGATGACTGG + Intergenic
1053783036 9:41630469-41630491 CAGACACTAAGGCACCTGAGAGG + Intergenic
1054170989 9:61840611-61840633 CAGACACTAAGGCACCTGAGAGG + Intergenic
1054666546 9:67740201-67740223 CAGACACTAAGGCACCTGAGAGG - Intergenic
1058772856 9:108254742-108254764 GAGACACTAAATGAGATGACAGG - Intergenic
1059287110 9:113183607-113183629 CAGGCAATAATTCACATGACAGG + Intronic
1062299655 9:135858393-135858415 CAGACACTATTTCAGATGACTGG + Intronic
1185619547 X:1445076-1445098 CAGACACAAATCCAGCCGTCTGG + Intronic
1188897379 X:35686108-35686130 CACACACTACTTCAGCCTACTGG - Intergenic
1188962704 X:36512227-36512249 TACACACTAAATCATCTGACAGG - Intergenic
1189613589 X:42763158-42763180 CAGACACTAATCCAGACAACTGG + Intergenic
1190072865 X:47293164-47293186 GGGACACTAATTCAGCTGACTGG - Intergenic
1193337974 X:80313086-80313108 CAGACACTAATTCAGCTGACTGG + Intergenic
1196179201 X:112671662-112671684 CAGACCCTAATTCAGTTATCTGG - Intronic
1198932102 X:141872598-141872620 CGGACACTAATTCAGCCGGCTGG - Intronic
1200286488 X:154827869-154827891 CAGACTCTGAATGAGCTGACAGG - Intronic
1200878057 Y:8180424-8180446 CAGATAGTAATTCAGATGACTGG - Intergenic
1201056121 Y:9994071-9994093 CAGATACTAATTCGGATGACTGG + Intergenic
1201630316 Y:16064213-16064235 CAGACACTAATGCAGCTGACTGG - Intergenic
1201630867 Y:16070937-16070959 CAGACACTAATTGAGCCAACTGG + Intergenic
1202237151 Y:22724847-22724869 CAGATACTATTTCAGATGACCGG + Intergenic