ID: 1193338865

View in Genome Browser
Species Human (GRCh38)
Location X:80322419-80322441
Sequence CATTTTAAGCAGTGGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193338861_1193338865 -6 Left 1193338861 X:80322402-80322424 CCAGAATCTCTGGGACACATTTT 0: 8
1: 2285
2: 4325
3: 4312
4: 2480
Right 1193338865 X:80322419-80322441 CATTTTAAGCAGTGGGTAGAGGG No data
1193338858_1193338865 19 Left 1193338858 X:80322377-80322399 CCAATGAGAACAAAGACACAATG 0: 619
1: 1188
2: 3515
3: 4822
4: 2577
Right 1193338865 X:80322419-80322441 CATTTTAAGCAGTGGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193338865 Original CRISPR CATTTTAAGCAGTGGGTAGA GGG Intergenic
No off target data available for this crispr