ID: 1193341384

View in Genome Browser
Species Human (GRCh38)
Location X:80352970-80352992
Sequence GAGGGTAAGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3016
Summary {0: 7, 1: 218, 2: 640, 3: 931, 4: 1220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193341384_1193341396 23 Left 1193341384 X:80352970-80352992 CCACCCTGCTTCTGCTTACCCTC 0: 7
1: 218
2: 640
3: 931
4: 1220
Right 1193341396 X:80353016-80353038 CCAGTCCCAATGAGATGAACAGG 0: 152
1: 412
2: 383
3: 237
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193341384 Original CRISPR GAGGGTAAGCAGAAGCAGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr