ID: 1193347220

View in Genome Browser
Species Human (GRCh38)
Location X:80417971-80417993
Sequence CATAATCCTGTATTTCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11093
Summary {0: 2, 1: 58, 2: 547, 3: 6927, 4: 3559}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193347215_1193347220 23 Left 1193347215 X:80417925-80417947 CCTTCTCTTTCAAGGGTGCCAAT 0: 1
1: 7
2: 61
3: 155
4: 519
Right 1193347220 X:80417971-80417993 CATAATCCTGTATTTCTTGGAGG 0: 2
1: 58
2: 547
3: 6927
4: 3559
1193347218_1193347220 5 Left 1193347218 X:80417943-80417965 CCAATCAGGTGTAGACTTGGTCG 0: 1
1: 0
2: 20
3: 1065
4: 3864
Right 1193347220 X:80417971-80417993 CATAATCCTGTATTTCTTGGAGG 0: 2
1: 58
2: 547
3: 6927
4: 3559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193347220 Original CRISPR CATAATCCTGTATTTCTTGG AGG Intronic
Too many off-targets to display for this crispr