ID: 1193351499

View in Genome Browser
Species Human (GRCh38)
Location X:80469903-80469925
Sequence TCCAGGACTCGTGTCGTTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193351499_1193351507 15 Left 1193351499 X:80469903-80469925 CCTCGAACGACACGAGTCCTGGA No data
Right 1193351507 X:80469941-80469963 GCTGAAGAAGACAACTCAGGAGG No data
1193351499_1193351506 12 Left 1193351499 X:80469903-80469925 CCTCGAACGACACGAGTCCTGGA No data
Right 1193351506 X:80469938-80469960 GATGCTGAAGAAGACAACTCAGG 0: 14
1: 17
2: 19
3: 21
4: 211
1193351499_1193351503 -10 Left 1193351499 X:80469903-80469925 CCTCGAACGACACGAGTCCTGGA No data
Right 1193351503 X:80469916-80469938 GAGTCCTGGACATTACCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193351499 Original CRISPR TCCAGGACTCGTGTCGTTCG AGG (reversed) Intergenic
No off target data available for this crispr