ID: 1193356253

View in Genome Browser
Species Human (GRCh38)
Location X:80523093-80523115
Sequence AGTTATCTGCAGAAGACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193356253_1193356257 14 Left 1193356253 X:80523093-80523115 CCTACTGTCTTCTGCAGATAACT No data
Right 1193356257 X:80523130-80523152 ACAACTCTTGGCCTGTTACTGGG 0: 17
1: 184
2: 186
3: 148
4: 230
1193356253_1193356254 2 Left 1193356253 X:80523093-80523115 CCTACTGTCTTCTGCAGATAACT No data
Right 1193356254 X:80523118-80523140 ACTCCTTTTGAGACAACTCTTGG No data
1193356253_1193356256 13 Left 1193356253 X:80523093-80523115 CCTACTGTCTTCTGCAGATAACT No data
Right 1193356256 X:80523129-80523151 GACAACTCTTGGCCTGTTACTGG 0: 17
1: 171
2: 183
3: 131
4: 176
1193356253_1193356258 23 Left 1193356253 X:80523093-80523115 CCTACTGTCTTCTGCAGATAACT No data
Right 1193356258 X:80523139-80523161 GGCCTGTTACTGGGCTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193356253 Original CRISPR AGTTATCTGCAGAAGACAGT AGG (reversed) Intergenic
No off target data available for this crispr