ID: 1193358897

View in Genome Browser
Species Human (GRCh38)
Location X:80556621-80556643
Sequence ACCTGAGGCCCTTTGTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193358897_1193358901 9 Left 1193358897 X:80556621-80556643 CCAGGAGACAAAGGGCCTCAGGT No data
Right 1193358901 X:80556653-80556675 GACAATGCAGCTGCTTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193358897 Original CRISPR ACCTGAGGCCCTTTGTCTCC TGG (reversed) Intergenic
No off target data available for this crispr