ID: 1193361786

View in Genome Browser
Species Human (GRCh38)
Location X:80587274-80587296
Sequence CCTTCTGTACTGATCTTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193361780_1193361786 25 Left 1193361780 X:80587226-80587248 CCAGTGAGATGAACAGTGTACCT No data
Right 1193361786 X:80587274-80587296 CCTTCTGTACTGATCTTACTGGG No data
1193361779_1193361786 26 Left 1193361779 X:80587225-80587247 CCCAGTGAGATGAACAGTGTACC 0: 4
1: 26
2: 325
3: 4705
4: 2596
Right 1193361786 X:80587274-80587296 CCTTCTGTACTGATCTTACTGGG No data
1193361781_1193361786 5 Left 1193361781 X:80587246-80587268 CCTCAGTTTGAAATGCAGAAATC 0: 25
1: 3418
2: 4500
3: 1081
4: 467
Right 1193361786 X:80587274-80587296 CCTTCTGTACTGATCTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193361786 Original CRISPR CCTTCTGTACTGATCTTACT GGG Intergenic
No off target data available for this crispr