ID: 1193364610

View in Genome Browser
Species Human (GRCh38)
Location X:80616896-80616918
Sequence CTTTCATCAGTTCTGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193364605_1193364610 22 Left 1193364605 X:80616851-80616873 CCCTGCTTGGCATTCATAGAGTT No data
Right 1193364610 X:80616896-80616918 CTTTCATCAGTTCTGGAAAAAGG No data
1193364606_1193364610 21 Left 1193364606 X:80616852-80616874 CCTGCTTGGCATTCATAGAGTTT No data
Right 1193364610 X:80616896-80616918 CTTTCATCAGTTCTGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193364610 Original CRISPR CTTTCATCAGTTCTGGAAAA AGG Intergenic
No off target data available for this crispr