ID: 1193365240

View in Genome Browser
Species Human (GRCh38)
Location X:80623604-80623626
Sequence CCCCACTCCCTAGCCAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193365240_1193365243 -4 Left 1193365240 X:80623604-80623626 CCTGTTTTGGCTAGGGAGTGGGG No data
Right 1193365243 X:80623623-80623645 GGGGGCTCCCCTGCCTCATGTGG 0: 4
1: 13
2: 38
3: 91
4: 305
1193365240_1193365246 4 Left 1193365240 X:80623604-80623626 CCTGTTTTGGCTAGGGAGTGGGG No data
Right 1193365246 X:80623631-80623653 CCCTGCCTCATGTGGCTCTCAGG No data
1193365240_1193365249 8 Left 1193365240 X:80623604-80623626 CCTGTTTTGGCTAGGGAGTGGGG No data
Right 1193365249 X:80623635-80623657 GCCTCATGTGGCTCTCAGGTGGG No data
1193365240_1193365248 7 Left 1193365240 X:80623604-80623626 CCTGTTTTGGCTAGGGAGTGGGG No data
Right 1193365248 X:80623634-80623656 TGCCTCATGTGGCTCTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193365240 Original CRISPR CCCCACTCCCTAGCCAAAAC AGG (reversed) Intergenic
No off target data available for this crispr