ID: 1193365714

View in Genome Browser
Species Human (GRCh38)
Location X:80629857-80629879
Sequence ATCTCCTTCTTGAGGAGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193365714_1193365721 28 Left 1193365714 X:80629857-80629879 CCTTGACTCCTCAAGAAGGAGAT No data
Right 1193365721 X:80629908-80629930 CTTTTCAAAGGTTAAGTCTGAGG No data
1193365714_1193365720 16 Left 1193365714 X:80629857-80629879 CCTTGACTCCTCAAGAAGGAGAT No data
Right 1193365720 X:80629896-80629918 CAATTTCACAATCTTTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193365714 Original CRISPR ATCTCCTTCTTGAGGAGTCA AGG (reversed) Intergenic
No off target data available for this crispr