ID: 1193365714 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:80629857-80629879 |
| Sequence | ATCTCCTTCTTGAGGAGTCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1193365714_1193365721 | 28 | Left | 1193365714 | X:80629857-80629879 | CCTTGACTCCTCAAGAAGGAGAT | No data | ||
| Right | 1193365721 | X:80629908-80629930 | CTTTTCAAAGGTTAAGTCTGAGG | No data | ||||
| 1193365714_1193365720 | 16 | Left | 1193365714 | X:80629857-80629879 | CCTTGACTCCTCAAGAAGGAGAT | No data | ||
| Right | 1193365720 | X:80629896-80629918 | CAATTTCACAATCTTTTCAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1193365714 | Original CRISPR | ATCTCCTTCTTGAGGAGTCA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||