ID: 1193366204

View in Genome Browser
Species Human (GRCh38)
Location X:80637176-80637198
Sequence AGCAGAAATGTCTCTCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193366197_1193366204 26 Left 1193366197 X:80637127-80637149 CCCAAGCCACAAGACAAGGACCT No data
Right 1193366204 X:80637176-80637198 AGCAGAAATGTCTCTCCCCATGG No data
1193366199_1193366204 20 Left 1193366199 X:80637133-80637155 CCACAAGACAAGGACCTTTGCTC No data
Right 1193366204 X:80637176-80637198 AGCAGAAATGTCTCTCCCCATGG No data
1193366201_1193366204 6 Left 1193366201 X:80637147-80637169 CCTTTGCTCTCTTTCTGGTCCTT No data
Right 1193366204 X:80637176-80637198 AGCAGAAATGTCTCTCCCCATGG No data
1193366198_1193366204 25 Left 1193366198 X:80637128-80637150 CCAAGCCACAAGACAAGGACCTT No data
Right 1193366204 X:80637176-80637198 AGCAGAAATGTCTCTCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193366204 Original CRISPR AGCAGAAATGTCTCTCCCCA TGG Intergenic
No off target data available for this crispr