ID: 1193366477

View in Genome Browser
Species Human (GRCh38)
Location X:80639591-80639613
Sequence TTGGCTGGACACACAATTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193366477_1193366480 -2 Left 1193366477 X:80639591-80639613 CCAAGAATTGTGTGTCCAGCCAA No data
Right 1193366480 X:80639612-80639634 AAACTAAGCTTCATAAATGAAGG 0: 554
1: 6882
2: 3666
3: 2400
4: 2054

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193366477 Original CRISPR TTGGCTGGACACACAATTCT TGG (reversed) Intergenic
No off target data available for this crispr