ID: 1193366822

View in Genome Browser
Species Human (GRCh38)
Location X:80644281-80644303
Sequence ACTCAGATGGTGTCCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193366822_1193366827 4 Left 1193366822 X:80644281-80644303 CCCTCCATGGACACCATCTGAGT No data
Right 1193366827 X:80644308-80644330 TCCAGTGTTGCCTTCTGACAGGG No data
1193366822_1193366826 3 Left 1193366822 X:80644281-80644303 CCCTCCATGGACACCATCTGAGT No data
Right 1193366826 X:80644307-80644329 GTCCAGTGTTGCCTTCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193366822 Original CRISPR ACTCAGATGGTGTCCATGGA GGG (reversed) Intergenic
No off target data available for this crispr