ID: 1193370754

View in Genome Browser
Species Human (GRCh38)
Location X:80694395-80694417
Sequence ACTAGGCAGTACCCCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193370754_1193370760 21 Left 1193370754 X:80694395-80694417 CCCCCACTGGGGTACTGCCTAGT No data
Right 1193370760 X:80694439-80694461 CCGTCCTCCAGACCCCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193370754 Original CRISPR ACTAGGCAGTACCCCAGTGG GGG (reversed) Intronic