ID: 1193370754

View in Genome Browser
Species Human (GRCh38)
Location X:80694395-80694417
Sequence ACTAGGCAGTACCCCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 2, 1: 20, 2: 48, 3: 77, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193370754_1193370760 21 Left 1193370754 X:80694395-80694417 CCCCCACTGGGGTACTGCCTAGT 0: 2
1: 20
2: 48
3: 77
4: 160
Right 1193370760 X:80694439-80694461 CCGTCCTCCAGACCCCAGAATGG 0: 131
1: 1376
2: 1918
3: 1517
4: 1044

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193370754 Original CRISPR ACTAGGCAGTACCCCAGTGG GGG (reversed) Intronic
902540730 1:17152652-17152674 ACTAGGCTGTGCCCCAGTTAGGG - Intergenic
902699799 1:18164025-18164047 ACTGGGCAGTCTCCCATTGGTGG - Intronic
903545512 1:24121267-24121289 ACTAGAAAGTGTCCCAGTGGGGG + Exonic
905020569 1:34808172-34808194 ACTAAGCATTGCCCAAGTGGGGG + Intronic
905979589 1:42211532-42211554 TAAAGGCAATACCCCAGTGGTGG - Intronic
909099377 1:71331982-71332004 ACTAGGCATTGCCCTAGTGGAGG + Intergenic
909405305 1:75281954-75281976 ACTAGGCAATGCCCCAGTGGAGG - Intronic
912068687 1:105779801-105779823 ACCAGGCAGTGCCCCAGTGAGGG - Intergenic
912084054 1:105977084-105977106 ACCAAGCAGTGCCCCAGTGTGGG - Intergenic
912778761 1:112524627-112524649 AGCAGGCAGTTCCCAAGTGGAGG - Exonic
913254181 1:116939192-116939214 ACTAGGCCATGCCCCAGTAGGGG + Intronic
913316574 1:117558779-117558801 ACTAGGTGGTGCCCCAGTAGGGG + Intergenic
914417877 1:147501178-147501200 ACTAGTCTGTGCACCAGTGGAGG + Intergenic
915786993 1:158624222-158624244 ACTAGGCAGTACCCCAGTGAGGG - Intronic
917152102 1:171956644-171956666 ACTAGGCAGTGCCCCAGTAAGGG + Intronic
917282046 1:173386605-173386627 ACTATGCATTACCCCAGTGGGGG - Intergenic
917408745 1:174736560-174736582 ACTAGGCAGTGCCCTGGTGGAGG + Intronic
917656768 1:177134386-177134408 ATTAGGCAGGACTCCAGGGGTGG - Intronic
919129215 1:193432816-193432838 ACTAGGCAGTGCCCCATGTGTGG + Intergenic
919536715 1:198796832-198796854 ATTAGACAGTGCCCCAGTGGGGG + Intergenic
920003660 1:202816707-202816729 ACTGGGCAGTACTCCAGAGAAGG - Intergenic
921220163 1:212967974-212967996 TCTAAGCAGTCCCCTAGTGGTGG - Intronic
921996554 1:221425839-221425861 ACTAGGCAGCACCCCAGTGGGGG + Intergenic
922709109 1:227813826-227813848 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
923179143 1:231499236-231499258 ACTAGGTAGTGCCCCAGTGGGGG + Intergenic
1062770465 10:96340-96362 ACTAGGCAGTGCCCCTGTGGGGG + Intergenic
1062868362 10:876722-876744 ACTAGGCAATGCCCTGGTGGGGG + Intronic
1065639535 10:27767865-27767887 TCCAGGCTGTACCACAGTGGGGG + Intergenic
1066533611 10:36366584-36366606 ACTAAGTACTACCCTAGTGGGGG - Intergenic
1066684248 10:37965279-37965301 ATTAGGCAGTACCCCAGTGGGGG - Intronic
1068147772 10:53093166-53093188 ACTAGGCAGTGCTCCTGTGTAGG - Intergenic
1068399419 10:56509055-56509077 ACTAGACAGTGCCCCAGTGGTGG - Intergenic
1068604512 10:58990424-58990446 ACTAGACAGTGCCTCAGTGGGGG - Intergenic
1069106120 10:64385136-64385158 ACTAGGCAGTGCTCCAGTGGGGG + Intergenic
1070581639 10:77724909-77724931 ACTAGGCAGTGGCCCAGTGGGGG - Intergenic
1070637659 10:78142170-78142192 ACTAGGCACTGCCCCGGTGGGGG - Intergenic
1070808671 10:79286300-79286322 ACCAGGCATTCCCCCGGTGGTGG + Intronic
1074290415 10:112133862-112133884 ACTATGAAATACTCCAGTGGTGG - Intergenic
1074657991 10:115616951-115616973 ACTAGGCAGTGCCCCAGTGAGGG - Intronic
1074803945 10:117028897-117028919 ATCAGGCAGTGCCTCAGTGGGGG - Intronic
1076875045 10:133211657-133211679 TCTAGGCAGAAGCACAGTGGTGG - Exonic
1077735151 11:4783065-4783087 ACTAGGTGGTGCCCCAGTAGGGG - Intronic
1079294624 11:19221882-19221904 ACTAGGTAGTAGCACAGTAGTGG - Intergenic
1084902369 11:72319161-72319183 CCTAGACAGTACCACATTGGAGG - Intronic
1085593928 11:77791006-77791028 ACTAGGCAGTGCCCCAGGTAGGG + Intronic
1086056600 11:82654217-82654239 ACTAGGCAGTGCCCCAGTAAAGG - Intergenic
1087336621 11:96852038-96852060 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1087675656 11:101158410-101158432 ACCAGGCTGTGCTCCAGTGGGGG - Intergenic
1088825775 11:113492730-113492752 ACTAGGCATTACCCAAATGCTGG - Intergenic
1089307434 11:117535475-117535497 ACTAGGCAGACCCCCACTCGGGG + Intronic
1090134009 11:124176865-124176887 ACTAGGCAGGGTCCCAGTGCAGG - Intergenic
1094815417 12:34178908-34178930 ACTAGGCCATGCCCCAGTGGGGG + Intergenic
1095216714 12:39557941-39557963 ACTAGGCAATGCCCCAGTGGGGG - Intronic
1095825901 12:46530728-46530750 GCTCGGCAGTCACCCAGTGGGGG - Intergenic
1096304669 12:50463798-50463820 ACTATGCAGTGCCCTAGTGGAGG + Intronic
1096980271 12:55724603-55724625 ACCAGGCAGTACCAGGGTGGGGG - Exonic
1097501520 12:60409819-60409841 CCTAGGCAATGCCCCAGTGGGGG + Intergenic
1097571238 12:61335000-61335022 ACTAGGCAATGCCCCAGTAAGGG + Intergenic
1097614447 12:61866704-61866726 ACTGGGCAGTGTCCAAGTGGTGG + Intronic
1098559082 12:71851939-71851961 ACTAGGCAGTGCTCTTGTGGAGG + Intronic
1099089892 12:78293035-78293057 ACTAGACAGTCCCAAAGTGGGGG - Intergenic
1099475584 12:83104280-83104302 ACTAGGCAGTGCCCCGTGGGGGG + Intronic
1099487789 12:83249566-83249588 ACTAGGCAGTTTCCCAGTTGGGG - Intergenic
1099635226 12:85204360-85204382 ACTAGGTGGTGCCCCAGTAGGGG - Intronic
1099663465 12:85596439-85596461 ACTAGGTGGTACCCCAGTAGGGG + Intergenic
1099760320 12:86912548-86912570 ACTAGGCAGTGTCTCAGTGGGGG - Intergenic
1099890828 12:88586530-88586552 ACTAGGCAGTGACCTAGTAGGGG + Intergenic
1099984701 12:89649149-89649171 ACTAAGCAGTGCCCTAGTGGGGG - Intronic
1100318521 12:93467598-93467620 ACTGGGCAGTCCCACAGTGTTGG + Intronic
1101052110 12:100874246-100874268 ACAAGGCAGTGCCCCAGTGAAGG - Intronic
1101673485 12:106897620-106897642 AAGAGGCAGTAACCCAGGGGTGG + Intergenic
1103789627 12:123460338-123460360 GCTAAGAAGTAGCCCAGTGGAGG - Intronic
1104742031 12:131184718-131184740 ACTAGGCAGTGCCCCAATGTGGG + Intergenic
1105506784 13:21017087-21017109 ACTGGGAAGCATCCCAGTGGTGG + Intronic
1108409096 13:50129921-50129943 ATTAGGAAATAACCCAGTGGTGG - Intronic
1109819856 13:67638724-67638746 ACTAGGCATTACCCTAGTAGAGG - Intergenic
1110062663 13:71062337-71062359 ACTTAGCAGTGCCCCAGTGGGGG + Intergenic
1111239690 13:85457871-85457893 ACTAGCCAGTGTCCCAGTGGGGG - Intergenic
1111425669 13:88078007-88078029 ACTCGGCTGAACCCCAGTGAGGG - Intergenic
1112137796 13:96602132-96602154 TATATGCAATACCCCAGTGGTGG + Intronic
1112582739 13:100690532-100690554 ACTAGGCAGTACCCCCAGTGGGG - Intergenic
1113029359 13:105976561-105976583 AGTAGGCAGTGCCCCAATGCGGG + Intergenic
1113269314 13:108655534-108655556 ACTAGGCAGTGCCCCAGTGGAGG - Intronic
1115340769 14:32291185-32291207 ACTAGGCAGTGCCCCACAGTGGG - Intergenic
1116095327 14:40359848-40359870 ACTAGGCAATGCCCCAGTCTGGG - Intergenic
1116098875 14:40408260-40408282 ACTAGGCAGTGCCCCAGTGAGGG + Intergenic
1116287177 14:42988122-42988144 ACTAGGCAGTGTCCCAGTAGGGG - Intergenic
1116485543 14:45444197-45444219 ATTAGGCAGTGCCCCAGTGTGGG - Intergenic
1116861075 14:49996084-49996106 AATAGGCAGAACCCCAAAGGAGG + Intronic
1119020580 14:71108724-71108746 ACAAGGCACAAACCCAGTGGTGG - Exonic
1119560989 14:75589614-75589636 ACTAGGCATTACCCTTGTGGGGG + Intronic
1121432812 14:93899549-93899571 ACAGGTCAGTACCGCAGTGGTGG - Intergenic
1121640246 14:95480505-95480527 ACCAGCCAGTCCCCCAGAGGTGG + Intergenic
1126592028 15:50350074-50350096 AGAAGGCAGTACCCCACTGTAGG + Intronic
1127576225 15:60295098-60295120 ACTAGGCAGTGCCCCAGCAGGGG + Intergenic
1129130327 15:73487820-73487842 ACTAGGCATTGCCCTGGTGGGGG + Intronic
1130977711 15:88789882-88789904 TCTAGTCAGTTTCCCAGTGGCGG - Intergenic
1131410234 15:92201288-92201310 ACTAGGTAGTGCCCTGGTGGGGG - Intergenic
1131987566 15:98060503-98060525 ACTAGGCAGTGCCCCAGTAGAGG + Intergenic
1132261812 15:100432402-100432424 ACCAGACAATTCCCCAGTGGAGG + Intronic
1132542617 16:518119-518141 ACTAGGCTGGAGCGCAGTGGCGG + Intronic
1137338066 16:47571316-47571338 TATATGCAGTACCCCAGTGGTGG + Intronic
1141888921 16:86913422-86913444 ACTAGGCTGTAACGCAGTTGAGG + Intergenic
1142995120 17:3755426-3755448 ACGAGGCAGGAGCCCAGTGTTGG - Intronic
1143450221 17:7031839-7031861 ACCAAGGACTACCCCAGTGGGGG + Intergenic
1143483973 17:7242852-7242874 ACAAAGTAGTACCCAAGTGGCGG + Intronic
1147792491 17:43022168-43022190 ACTAGGCAGCGCAGCAGTGGCGG + Exonic
1148390502 17:47268800-47268822 ACTAGGCAGTGCCCGAGTGGGGG + Intronic
1149052675 17:52325479-52325501 ACTAGGCAGTGCCCCAGTAAGGG + Intergenic
1149135573 17:53359676-53359698 ACTAGGCAGTGCCCCTGTGGGGG - Intergenic
1151422837 17:74009752-74009774 ACCAGGCAGTCCCACAGTGGGGG - Intergenic
1153011918 18:547196-547218 ATTAGGCAGTGACCCAGTAGGGG + Intergenic
1155021873 18:21903960-21903982 ACTAGGGAAAACCCCACTGGCGG + Intergenic
1155528415 18:26741228-26741250 ACTTGGCAGTATCCCAGCTGGGG + Intergenic
1156154680 18:34287693-34287715 GCTAGGCAGTACCCCAGTGGGGG + Intergenic
1159697316 18:71575851-71575873 ACTAGGCAGTACCCCAGTGGGGG + Intergenic
1159713890 18:71797675-71797697 ACTAGGTATTGCCCCAGTGGGGG - Intergenic
1163110925 19:15160761-15160783 GGCAGGCAGTGCCCCAGTGGTGG + Exonic
1164503375 19:28838150-28838172 ACTAGACAGAAGCCCAGTGAGGG - Intergenic
1166164921 19:40980673-40980695 ACTAAGCAGTGCCCCAGCAGAGG + Intergenic
929260068 2:39856434-39856456 AGAAGGGAGTAGCCCAGTGGAGG + Intergenic
930687560 2:54325696-54325718 ACTAGGCAATGCTCCAGTGGGGG - Intergenic
931154137 2:59608378-59608400 ACTAGGCAGTGCTTTAGTGGGGG - Intergenic
932583756 2:73009353-73009375 ACGAGGCAGTGGCCCAGGGGTGG + Intronic
934144192 2:89075469-89075491 ACTAAGCAGTGCCCCAGTAGGGG - Intergenic
934225051 2:90125079-90125101 ACTAAGCAGTGCCCCAGTAGGGG + Intergenic
935437092 2:103046502-103046524 GCTGGGCATTACCCAAGTGGAGG + Intergenic
936788756 2:116125418-116125440 ATTAGGCAGTGGCCCAGTGGTGG + Intergenic
936792346 2:116164747-116164769 ACTAAGCAGTGCCCCAGTAGGGG - Intergenic
937206037 2:120237793-120237815 GCTAGGCAGTGTTCCAGTGGGGG - Intergenic
939249013 2:139662394-139662416 ACTATGCAATGCTCCAGTGGGGG + Intergenic
940288948 2:152059195-152059217 ACTATGCAGTGCCCCAGTGGGGG - Intronic
940425930 2:153532069-153532091 ACTAAGCAGTGCCCCAGTGGGGG + Intergenic
940598017 2:155819430-155819452 ATTAGGCATTGCCCCACTGGAGG - Intergenic
940790747 2:158027641-158027663 ACTAGACGGTACCCCAGTAGGGG + Intronic
941527001 2:166618487-166618509 ACTAGACAGTGCCCCAGTGGGGG - Intergenic
941570237 2:167161288-167161310 ACTAGGTGGTGCCCCAGTAGGGG + Intronic
943092966 2:183395897-183395919 ACTAGGCAGTGCCCCAGTACAGG - Intergenic
943690928 2:190868947-190868969 ACTTGGCATTGCCCCAGTAGAGG + Intergenic
943788198 2:191901636-191901658 ATTAGGCAGTGCCCCAATAGGGG - Intergenic
943876200 2:193071142-193071164 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
944477750 2:200124810-200124832 ACTAAGCAGTGCCCCAGTGGGGG + Intergenic
944479734 2:200144401-200144423 ACTAGGCAGTACCGCAGTGGGGG + Intergenic
945360151 2:208886882-208886904 ACTAGGCAATGCCCCAGTAGGGG - Intergenic
945457124 2:210063373-210063395 ACTAGGTGGTGCCCCAGTAGGGG - Intronic
1175736513 20:61391015-61391037 AGGAGGCAGTGCCGCAGTGGGGG + Intronic
1177522115 21:22239322-22239344 ACTAGGCAATGGCCCAGTGGGGG - Intergenic
1178472671 21:32907372-32907394 AATAGGCAGGAGCCCAGTGGTGG + Intergenic
1178903339 21:36615354-36615376 ACTAGGCATTGCCCTAGTGAAGG + Intergenic
1179341684 21:40516746-40516768 ACTCTGCAGTGCCCCAGTGTGGG + Intronic
1180218759 21:46344546-46344568 CCTAGCCAGTTCCCCAGTTGGGG + Intronic
1182940268 22:34270090-34270112 ACTAGGCATTGCCCCAGTAGGGG + Intergenic
949095518 3:81033-81055 TTTTGGCAGCACCCCAGTGGAGG + Intergenic
950002417 3:9667518-9667540 AGTAGGATGTACTCCAGTGGGGG - Intronic
951180652 3:19654760-19654782 ACCAGGCAGTGCCCCAGCTGGGG + Intergenic
951449347 3:22819058-22819080 ACTAGGCAGTGCCCCAGTTGGGG + Intergenic
952589382 3:34932464-34932486 ACCAGGCAGTGCCCCAGTGGGGG - Intergenic
953377954 3:42444701-42444723 ACTGGGCAGTGCCCCAGTGAGGG - Intergenic
953408546 3:42673445-42673467 ACTGGCCAGTGCCCTAGTGGGGG - Intergenic
953446658 3:42974327-42974349 ATTAGGCAGTGCCCTAGTAGGGG - Intronic
954591603 3:51788083-51788105 ACCAGGCAGTGCCCCAGTAGGGG - Intergenic
954745904 3:52787452-52787474 AGGAGGCAGGACCCCAGGGGAGG + Intronic
956067465 3:65412189-65412211 AGGAGGCAGTTCCGCAGTGGAGG - Intronic
956246248 3:67186520-67186542 ACTAGGCAGTACCTCAGTGTGGG + Intergenic
956572516 3:70712546-70712568 ACTAGTCAGTGCTCCAGTGGGGG + Intergenic
957674323 3:83347122-83347144 ACTAGGCGGTTCCCCGGTAGGGG - Intergenic
958196260 3:90245570-90245592 ACTAGGCATTGCCCTGGTGGGGG + Intergenic
958419452 3:93914212-93914234 ACTAGGCATTGCCCTGGTGGGGG + Intronic
958861054 3:99445731-99445753 ACTAGGCAGTACCCCCAGTGGGG - Intergenic
959818508 3:110704131-110704153 ACTAGGTAGTGACCCAGTGAAGG + Intergenic
960121388 3:113951250-113951272 ACTGGGCAGTGCCCTAGTGGGGG + Intronic
960581483 3:119282854-119282876 ATGAGGCAGTGCCCCAGTGGGGG - Intergenic
961096110 3:124158236-124158258 ACCAGGCAGAAGCCCAGAGGAGG - Intronic
961316327 3:126038245-126038267 ACTAGGCATTGGCCAAGTGGGGG - Intronic
961477456 3:127157592-127157614 ACTAGGCAGCCCCCCAATGGAGG + Intergenic
962461039 3:135612881-135612903 AATAGGCAGTGTCCCAGTGGGGG - Intergenic
962636655 3:137338662-137338684 ACTAACCAGTGCCCCAGTTGGGG - Intergenic
963511378 3:146252176-146252198 ACTTGGCAGAACCCCATTGTGGG + Intergenic
963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
963656246 3:148055044-148055066 AACAGGTAGCACCCCAGTGGAGG + Intergenic
964719342 3:159756110-159756132 ACTAGACAGTACCTCAGTAGGGG + Intronic
964895504 3:161590625-161590647 ACTAGGCAGTGCCCCTGGTGGGG + Intergenic
965301529 3:167011256-167011278 ACTAGGCAGTGCCCCTGGTGGGG + Intergenic
966216450 3:177508132-177508154 ACTAGGCATTACCCTAGTGGGGG - Intergenic
967582773 3:191179363-191179385 AGTAGGCAGTGCCCCAGTTGAGG - Intergenic
967633918 3:191778611-191778633 ACCAGGTAGTGCCCCAGTGTGGG - Intergenic
967883630 3:194318536-194318558 ACTAGGCAGTGTCCTGGTGGGGG + Intergenic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
969566531 4:7982030-7982052 ACTCAGCAGTACCCTAGTGCTGG - Intronic
969997096 4:11324307-11324329 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
971510482 4:27417524-27417546 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
971710536 4:30105604-30105626 ACTAGGCAGTGCCTCTGTGTGGG + Intergenic
971815101 4:31477063-31477085 ACTAGGCAATGCCCAAGTCGGGG - Intergenic
971962556 4:33507763-33507785 ACTAGGCAGTGCCCTAGTTGGGG - Intergenic
973831811 4:54768890-54768912 AATAGGAAGTACCTTAGTGGTGG - Intergenic
974485124 4:62494500-62494522 ATTAGGCAATGCCCCAGTGGGGG - Intergenic
974666525 4:64969390-64969412 ACTAGGCAGTGTACAAGTGGGGG + Intergenic
974716897 4:65679181-65679203 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
974845997 4:67351693-67351715 CCTAAGCAGCTCCCCAGTGGAGG + Intergenic
975301685 4:72797795-72797817 ACTAGGCAGTTTCCCAGTGGGGG + Intergenic
976715669 4:88120308-88120330 ACTAAGCAGTGCCTCAGTGGGGG - Intronic
976755963 4:88498193-88498215 ACTAGGCATTGCCTTAGTGGGGG - Intronic
978920267 4:114175257-114175279 ACTAGGCAGTACTCCAGTAGGGG + Intergenic
979087235 4:116428498-116428520 AATAGGCAGTGCCCCAGTGGGGG - Intergenic
979664171 4:123292888-123292910 TATATGCAATACCCCAGTGGTGG + Intronic
980727875 4:136788073-136788095 ACTAGGCAGTGCCCTGGTAGGGG - Intergenic
981548223 4:145916165-145916187 ACTAGGCATTGCCCTAGTTGGGG + Intronic
981799318 4:148637300-148637322 ACTAGGCAGTGCCCCAGTTAGGG + Intergenic
981959786 4:150522886-150522908 ACTAGGCATTGCCCTAGTGGGGG - Intronic
982987744 4:162232199-162232221 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
983419214 4:167496290-167496312 ACTAGGCAGTGCCCCAGTTGGGG + Intergenic
983469288 4:168136784-168136806 ACTAGGCAGTGTCCCAGTGTGGG + Intronic
983713972 4:170754685-170754707 ACTAAACAGTTCCCCAGTAGGGG - Intergenic
984431905 4:179661051-179661073 ACTAAGCATTGCCCTAGTGGAGG - Intergenic
985337679 4:188913919-188913941 ACTAGGTGGTGCCCCAGTAGGGG + Intergenic
986014706 5:3747781-3747803 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
986533424 5:8761979-8762001 ACTAGGCAGTGCCCTAGTGAGGG - Intergenic
987794390 5:22608039-22608061 ACTAGGCAATGCCTCAGTTGGGG - Intronic
987881296 5:23749510-23749532 ACTAGGCAGTGACCCAGTGGGGG + Intergenic
987983876 5:25121578-25121600 ACTGGGCAGTGCCCCAGTGGGGG + Intergenic
988257144 5:28835294-28835316 GCTAGGCATCACCCTAGTGGGGG + Intergenic
990093384 5:52083078-52083100 ACTAGGCAGTGCCCCAGTAGGGG + Intergenic
990137645 5:52666163-52666185 AATAGTCAGTACCACAGTTGGGG + Intergenic
991321950 5:65383761-65383783 ACTAGGCATTGCCCTAGTGGGGG + Intronic
992128415 5:73666427-73666449 ACTCGGAATTACCCTAGTGGAGG + Intronic
992852925 5:80829004-80829026 ACTAGACATTACCCCACTTGGGG + Intronic
993117545 5:83735638-83735660 ACTAGGCAGTGCACCAGTGGCGG - Intergenic
993120193 5:83765435-83765457 ATTAAGCACTACCCCAATGGGGG + Intergenic
993967149 5:94372293-94372315 GCTAGGCAGTGCCCCAGTGGGGG + Intronic
994787595 5:104184288-104184310 AGTAGTCATTACTCCAGTGGTGG - Intergenic
995686299 5:114776242-114776264 ACTAGGCACTGCCCTAGTAGAGG + Intergenic
996098142 5:119420749-119420771 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
998812009 5:145975767-145975789 GCTAGGCACTGCCCCAGTAGGGG - Intronic
1000674618 5:164105600-164105622 ACTATGCAGTGTCCCAGTGGGGG - Intergenic
1000751074 5:165097449-165097471 ACTAGGCAGTGCCCCAGTAAGGG + Intergenic
1000932155 5:167264583-167264605 ACTATCCAATACCCCAGTGAGGG - Intergenic
1001181632 5:169526058-169526080 ACTAGACAGTGCCCCAGTAGGGG + Intergenic
1001389333 5:171366279-171366301 ACTTTGCATTACCCCAGTGTAGG + Intergenic
1002757155 6:172799-172821 ACTAGGCAGTGCCCCAGGTGGGG - Intergenic
1010055149 6:71556377-71556399 ACTAGGCAGTGCTTCAGTGTGGG - Intergenic
1010898241 6:81392604-81392626 ATTAGGCAGTGTCCCAGTGGAGG - Intergenic
1011345832 6:86368889-86368911 ACCAGGCAGTGCCCTAGTAGAGG - Intergenic
1012118418 6:95333891-95333913 ACTATGCAGTACCTTAGTGGGGG + Intergenic
1012649579 6:101736296-101736318 ACTAGGCAGTGCCCCAGTAGGGG + Intronic
1013613398 6:111817884-111817906 ACCAGACAGTGCCCCAGTGGAGG - Intronic
1014068112 6:117150571-117150593 ACTAGGCAGTGCCCCAGTAGGGG + Intergenic
1014563053 6:122914089-122914111 ACTAGGCAGTGCCCCAGTTGGGG - Intergenic
1017309257 6:152957192-152957214 ACTAGCCATTGCCCTAGTGGGGG - Intergenic
1018527493 6:164729086-164729108 ACTAGGCAGTGCCTCAGTGAAGG - Intergenic
1018573767 6:165236853-165236875 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
1020945533 7:14600959-14600981 ACTAGGCATTGTCCTAGTGGAGG + Intronic
1021750604 7:23795512-23795534 ACTAGGCAGTACACCAGTTGGGG - Intronic
1023303026 7:38793793-38793815 AGAAGGCAGTACCACTGTGGAGG - Intronic
1027584781 7:80044629-80044651 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1033885064 7:145934277-145934299 ACTAGTCAGTGCCCCAGTGCGGG - Intergenic
1033910732 7:146260319-146260341 ACTAGGCAGTGCCCCAGGTGGGG - Intronic
1037821378 8:22136629-22136651 ACTAAGCAGTACCAGAGTGAAGG - Intergenic
1038359903 8:26865826-26865848 GCTAGGCAGGTTCCCAGTGGTGG - Intronic
1038793861 8:30692831-30692853 AATAGGGAGTACCCTAGAGGTGG + Intronic
1042975083 8:74459924-74459946 ATTAGGAAGTAATCCAGTGGTGG - Intronic
1043993157 8:86780825-86780847 ACTAGGCAGTGCCCCAGTTTGGG - Intergenic
1044273662 8:90275469-90275491 ACTAGGCAGCACGCCAGTGGGGG - Intergenic
1044324815 8:90847503-90847525 ACTAGGCAGTGCCTCAGGTGGGG + Intronic
1044718600 8:95124036-95124058 ACTAGGCAGAGCCCCAGTGGGGG - Intergenic
1045422127 8:102026719-102026741 ACTAGGCAGTGCCCCAGTGGAGG + Intronic
1045735995 8:105296842-105296864 ACTAGGCCGTACCCCAGTAGGGG + Intronic
1046146848 8:110171977-110171999 ACTAGGCAGTGCACCAGTGGGGG - Intergenic
1046489246 8:114926605-114926627 ACTAGGCAGTAACAGAATGGAGG - Intergenic
1047869977 8:129071684-129071706 ACTAGGCAGTGACCCTGTGTGGG - Intergenic
1048404609 8:134107032-134107054 ACTAGGCAGTGCCCCAGGAAAGG - Intergenic
1049088104 8:140493582-140493604 CCTTGACAGTACCACAGTGGAGG + Intergenic
1052577752 9:30311996-30312018 ATTAGGCAGTGCCCCAGTGTGGG + Intergenic
1055175549 9:73313800-73313822 ACTAGGCAGTGTCCCAGTAGGGG + Intergenic
1057081167 9:92175735-92175757 GCATGGCAGTACCTCAGTGGTGG + Intergenic
1057331669 9:94120878-94120900 ACTAGGCACTGCCCTAGTGGGGG - Intergenic
1058230369 9:102417427-102417449 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
1058309761 9:103485669-103485691 ACTAGGCAGTGCTCCAGATGGGG - Intergenic
1058499024 9:105591708-105591730 AGTAGGCAGTGCCCCAGTGGGGG + Intronic
1060549122 9:124476882-124476904 ACCAGGCAGTACCCCTTGGGAGG + Intronic
1062639444 9:137510792-137510814 ACCAGGCAGTGCCCCCGTGTGGG + Intronic
1187133569 X:16525877-16525899 ACTAAGCAGTGCCCCAGTTGGGG + Intergenic
1187401859 X:18967238-18967260 ACTGAGCAGGACCCCACTGGTGG + Intronic
1187612238 X:20955279-20955301 ACTAAGCATTTCCCTAGTGGAGG + Intergenic
1188134918 X:26483648-26483670 ACTAGGCAGTGTCCCAGTGGGGG - Intergenic
1189170067 X:38900690-38900712 ACTAGGCATTGCCCTAGTGGGGG - Intergenic
1189435712 X:40990949-40990971 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1190362337 X:49661134-49661156 ACCAGGCAGAACCACAGCGGTGG - Intergenic
1190772554 X:53527294-53527316 ACCAGGCAGTGTCCCAGTGGGGG - Intergenic
1191987711 X:67000549-67000571 ACTAGGCAGTGCCCCAGTGGAGG + Intergenic
1192713556 X:73616474-73616496 ACTAGGCAGTGCCCCAGTGAGGG + Intronic
1192923948 X:75736233-75736255 AGGAGGTAGTAACCCAGTGGTGG - Intergenic
1193370754 X:80694395-80694417 ACTAGGCAGTACCCCAGTGGGGG - Intronic
1193388220 X:80895358-80895380 ACTTGGCAATGCCCCAGTTGGGG - Intergenic
1193865040 X:86720734-86720756 TCTAGGCAGTGCCCCAGTGGGGG + Intronic
1193879809 X:86908194-86908216 ACTAGGTATTGCTCCAGTGGGGG + Intergenic
1194178838 X:90688387-90688409 ACTATTCAGTGCCCCAGTGGTGG + Intergenic
1194850258 X:98860188-98860210 ACTAGGCAGTGCCCCACTGGGGG - Intergenic
1195536337 X:106012984-106013006 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1196723388 X:118875475-118875497 ACTAGGCATTGCCCTAGTGGGGG - Intergenic
1197088651 X:122510134-122510156 ACTAGGCAGTGCCCCAGTGTGGG + Intergenic
1197342396 X:125288891-125288913 ACTAGGCACTGCCTTAGTGGGGG - Intergenic
1197439954 X:126475890-126475912 ACTAGGCAGTGCCCTAGTGGGGG + Intergenic
1197451856 X:126629107-126629129 ACTAGGTAGTGTTCCAGTGGGGG + Intergenic
1197689673 X:129485047-129485069 ACTAGGCAGTGCCCTTGTTGGGG - Intronic
1198865660 X:141120472-141120494 ACTGGGCATTGCCCTAGTGGGGG + Intergenic
1198941696 X:141963835-141963857 ACTAGGCAGTGCCCTAGTGAGGG + Intergenic
1200525502 Y:4270557-4270579 ACTATTCAGTGCCCCAGTGGTGG + Intergenic