ID: 1193371045

View in Genome Browser
Species Human (GRCh38)
Location X:80697550-80697572
Sequence CATTTGTAAGAGAGGGCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193371037_1193371045 30 Left 1193371037 X:80697497-80697519 CCAATGTCTATCATTTCCATCTA 0: 1
1: 0
2: 18
3: 182
4: 802
Right 1193371045 X:80697550-80697572 CATTTGTAAGAGAGGGCGTGTGG 0: 1
1: 0
2: 1
3: 13
4: 246
1193371040_1193371045 -7 Left 1193371040 X:80697534-80697556 CCAACTGTTTAGTACCCATTTGT 0: 1
1: 0
2: 3
3: 55
4: 474
Right 1193371045 X:80697550-80697572 CATTTGTAAGAGAGGGCGTGTGG 0: 1
1: 0
2: 1
3: 13
4: 246
1193371039_1193371045 2 Left 1193371039 X:80697525-80697547 CCAGTTGTACCAACTGTTTAGTA 0: 1
1: 0
2: 0
3: 10
4: 204
Right 1193371045 X:80697550-80697572 CATTTGTAAGAGAGGGCGTGTGG 0: 1
1: 0
2: 1
3: 13
4: 246
1193371038_1193371045 14 Left 1193371038 X:80697513-80697535 CCATCTACATGTCCAGTTGTACC 0: 1
1: 0
2: 0
3: 44
4: 606
Right 1193371045 X:80697550-80697572 CATTTGTAAGAGAGGGCGTGTGG 0: 1
1: 0
2: 1
3: 13
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193371045 Original CRISPR CATTTGTAAGAGAGGGCGTG TGG Intronic
900988242 1:6085781-6085803 CATCTGTAAGAGGGTGTGTGTGG + Intronic
902550756 1:17218181-17218203 CAGTTGCAAGAGAGGGCATCTGG + Intronic
906082060 1:43098763-43098785 CATTTATAAGTGAGAACGTGAGG - Intergenic
908396387 1:63729060-63729082 CAAAGGTAAGAGAGGGTGTGGGG + Intergenic
909101420 1:71354023-71354045 CATTTGTAAGTGAGAACCTGTGG - Intergenic
912279264 1:108296207-108296229 CATTTATAAGTGAGAACGTGAGG + Intergenic
912288962 1:108398150-108398172 CATTTATAAGTGAGAACGTGAGG - Intronic
912470401 1:109902746-109902768 CATTAGGAAGTGAGGGCTTGGGG - Intergenic
913278762 1:117164871-117164893 CATTTGAAAGAGAGGTTGAGGGG - Intronic
913966005 1:143378022-143378044 CACTTATAAGAGAGGACATGAGG + Intergenic
914060379 1:144203630-144203652 CACTTATAAGAGAGGACATGAGG + Intergenic
914118771 1:144762739-144762761 CACTTATAAGAGAGGACATGAGG - Intergenic
914245606 1:145883712-145883734 CATTTGTCAGAGAAGTAGTGTGG - Intronic
914515101 1:148367688-148367710 TATTTCAAAGAGAGGGAGTGTGG + Intergenic
915048059 1:153035717-153035739 CATTTGTAAGTGAGAACATGTGG + Intergenic
916564551 1:165962185-165962207 CACTTGTAAGTGAGGACATGTGG - Intergenic
916947544 1:169743848-169743870 CACTTGTAGGAGAGGCAGTGTGG - Intronic
916967316 1:169963179-169963201 CATTTATAAGTGAGAGCATGTGG + Intronic
918789855 1:188812748-188812770 CACTTGTAAGAGAGAACATGCGG - Intergenic
918976234 1:191490000-191490022 CACTTGTAAGTGAGAGCATGTGG + Intergenic
920079436 1:203361684-203361706 CATGTGTAGGAGAGGGCGATGGG + Intergenic
920991559 1:210944567-210944589 TATCTGTAAGAGAAGGGGTGTGG - Intronic
923089466 1:230728794-230728816 CATTAGTAAAAGAGGATGTGAGG - Intergenic
924463226 1:244277770-244277792 CATTTATAAGTGAGAACGTGTGG + Intergenic
924599452 1:245475533-245475555 TATTTGTAAGAGATGGAGTCTGG - Intronic
924814822 1:247432326-247432348 CACTTGTAAGTGAGAACGTGTGG + Intronic
1062854229 10:771721-771743 CACTTATAAGTGAGGACGTGTGG - Intergenic
1063264807 10:4435923-4435945 CATCTGTAAGAGAGGACATAGGG - Intergenic
1063760571 10:9070333-9070355 CACTTATAAGTGAGGACGTGTGG + Intergenic
1065286539 10:24192573-24192595 CATTTGGGACAGAGGGCATGGGG + Intronic
1065472179 10:26093759-26093781 CAGTTTTAAGAGAGGGGGAGAGG - Intronic
1065496089 10:26329932-26329954 CACTTGTAAGTGAGGACATGTGG - Intergenic
1065592291 10:27276837-27276859 CATTTGTAAGTGAGAACATGTGG - Intergenic
1066193899 10:33080102-33080124 CATGTGTAAGTGAGAGCATGTGG + Intergenic
1066354533 10:34669367-34669389 CATTTATAAGTGAGAACGTGTGG - Intronic
1068091023 10:52432125-52432147 CACTTGTAAGTGAGAACGTGTGG + Intergenic
1068832617 10:61514615-61514637 CATTTGTAAGTGAGAACATGTGG + Intergenic
1069227413 10:65960747-65960769 CACTTGTAAGTGAGGACATGTGG + Intronic
1071256332 10:83875223-83875245 CTTTTCTCAGAGAGGGCCTGGGG + Intergenic
1071439898 10:85680899-85680921 CACTTGTAAGTGAGAGCATGTGG - Intronic
1071721368 10:88149813-88149835 CCTTTGGAAGAGAGGGAGCGTGG + Intergenic
1074013676 10:109510255-109510277 CATTTATAAGTGAGAGCATGTGG + Intergenic
1076509042 10:130999310-130999332 CATTTGGAAGGGAGGGAGAGAGG + Intergenic
1077619966 11:3712407-3712429 CAAGTGCAAGGGAGGGCGTGAGG - Intronic
1081984547 11:47292150-47292172 CATTTGGTAGAGAGAGTGTGTGG + Intronic
1082760021 11:57118475-57118497 CATTTGTAAGTGAGAACATGTGG - Intergenic
1085141295 11:74144679-74144701 CACTTGTAAGTGAGAACGTGTGG + Intronic
1086122928 11:83318990-83319012 CATTTCCAAGAGAGGGGCTGAGG + Intergenic
1086251386 11:84819055-84819077 TATTTGTGAGTGAGGGAGTGTGG - Intronic
1087107863 11:94429579-94429601 CACTTGTAAGTGAGGACATGTGG - Intronic
1087577938 11:100013100-100013122 CATTTGTAAGTGAGAACATGTGG - Intronic
1087937968 11:104057439-104057461 CACTTCTAAGTGAGGGCATGTGG - Intronic
1091943869 12:4516625-4516647 CATTTATAAGTGAGAGCATGTGG - Intronic
1092192837 12:6533295-6533317 CACTTGTAAGGAAGGGGGTGGGG - Intergenic
1093371572 12:18372882-18372904 CATTTGTGAGAGATGGCATCTGG + Intronic
1093516169 12:19989478-19989500 CATTTGTAAGAGAAGAATTGGGG + Intergenic
1094462077 12:30707123-30707145 CATTTGTAAGAGATAGAGTAGGG - Intergenic
1094790729 12:33911641-33911663 CATTTGTAAGTGAGAACATGTGG + Intergenic
1095675352 12:44910914-44910936 CACTTATAAGAGAGAGCATGTGG - Intronic
1097107467 12:56634245-56634267 CAGTTGGGAGAGAGTGCGTGGGG - Intronic
1098140969 12:67450089-67450111 CATCTGTAGGAGTGGGCGGGAGG + Intergenic
1098878946 12:75896928-75896950 CACTTGTAAGTGAGAGCATGGGG - Intergenic
1098979293 12:76937647-76937669 CACTTGTAAGAGAGAACATGAGG + Intergenic
1102670915 12:114618134-114618156 CACTTGTAAGAGAGAACATGGGG - Intergenic
1103928649 12:124437531-124437553 CATTTGTAAGGGTGCGCCTGCGG + Intronic
1105716623 13:23071976-23071998 CACTTGTAAGAGAGAACATGTGG + Intergenic
1105822615 13:24093387-24093409 CATTTTTAAAAGAGGACGTATGG + Intronic
1107112067 13:36708698-36708720 CATTTGTAAGTGAAGACATGTGG + Intergenic
1107334007 13:39334126-39334148 CATTTATGAGTGAGGACGTGCGG - Intergenic
1107455655 13:40552409-40552431 CATCTGTAAGATAGGGAGAGAGG - Intergenic
1107645948 13:42494715-42494737 CATTTGCCAAAGAGGGGGTGGGG - Intergenic
1108219814 13:48221984-48222006 AATTGGGCAGAGAGGGCGTGGGG - Intergenic
1108956286 13:56162421-56162443 CACATGTAAGAGAGGTCTTGTGG - Intergenic
1109551491 13:63907739-63907761 CATATGTAAGAGAGAACATGTGG - Intergenic
1109589633 13:64461022-64461044 CACTTTTAAGTGAGAGCGTGTGG + Intergenic
1109880312 13:68464957-68464979 CATTTGTAAGTGAGGAAATGTGG + Intergenic
1115402496 14:32978260-32978282 CATTTGTAAGATTGGGAGTTGGG + Intronic
1115508210 14:34112774-34112796 CACCTGGAAGAGAGGGTGTGGGG - Intronic
1115963066 14:38857465-38857487 CACTTGTAAGTGAGGACATGAGG + Intergenic
1115981071 14:39052071-39052093 CACTTGTAAGTGAGAGCATGTGG - Intronic
1117739458 14:58801635-58801657 CATTTATAAGTGAGAACGTGTGG + Intergenic
1117766502 14:59088915-59088937 CATTTATAAGTGAGAGCATGTGG + Intergenic
1118504247 14:66393219-66393241 CATTTCTCAGAGAAGGGGTGTGG + Intergenic
1124079167 15:26475360-26475382 GATTTGGAAGAGAGGACGCGAGG + Intergenic
1124598838 15:31114245-31114267 CATTTATAAGTGAGGACATGTGG + Intronic
1124613008 15:31221952-31221974 CATTTCTAAGAGAGGGTGAAGGG + Intergenic
1126530700 15:49707692-49707714 CATTTGTAAGCGAGAACATGTGG + Intergenic
1126758925 15:51951096-51951118 GATTTGTAAGAAAGGCCCTGAGG + Intronic
1126798837 15:52282238-52282260 AATGTGTAAGGGAGGGAGTGTGG - Intronic
1131274212 15:90967230-90967252 CATGTGTAAGAGAGGCAGTATGG - Intronic
1134304546 16:13020436-13020458 CATTTGTAAGTGAGAACATGCGG + Intronic
1134777784 16:16867922-16867944 CCTTTGTAAGAGAGAGAATGGGG - Intergenic
1136932606 16:34432684-34432706 CAATGGGAAGAGAGGGCGGGAGG - Intergenic
1136971966 16:34979130-34979152 CAATGGGAAGAGAGGGCGGGAGG + Intergenic
1141011589 16:80405393-80405415 CATTTGTTGGAAAGGGCGTCTGG + Intergenic
1142477836 17:200195-200217 CAGGTGTGAGAGAGGGTGTGAGG - Intergenic
1143415996 17:6750938-6750960 CATTTGGAAGAGAGGTTGTAAGG - Intergenic
1145206479 17:20987076-20987098 CATTTGTAAGTGAGAACATGCGG - Intergenic
1147390874 17:40108372-40108394 CATGTGCAAGCGAGGGGGTGGGG + Intergenic
1149074945 17:52584658-52584680 CATTTGTAATTGAGGGGGTCTGG + Intergenic
1150282622 17:63938267-63938289 CACCTGGAAGAGAGGGAGTGTGG + Intergenic
1151373697 17:73667697-73667719 CATGTGTCAGACAGGGCATGAGG + Intergenic
1151809770 17:76431847-76431869 CATTTGTAGGAGCGGATGTGTGG - Intronic
1153446560 18:5179276-5179298 CATTTGTAAGTGAGAACATGTGG + Intronic
1154179071 18:12114051-12114073 CATTTGTGAGAGAGAACATGTGG - Intronic
1156429043 18:37050965-37050987 CATTTGTAAAAGAGAGGGTTGGG - Intronic
1156639258 18:39070427-39070449 CAGTTGGAAGTTAGGGCGTGTGG - Intergenic
1157112708 18:44835847-44835869 CATTTTTAAAAGAAGGCCTGAGG + Intronic
1160074030 18:75654861-75654883 CATTTGGGAGAGAGGGTCTGTGG - Intergenic
1160479424 18:79225250-79225272 CAATTGTAAAAGAGAGCGTTTGG - Intronic
1160816938 19:1040436-1040458 CATTTGTAAGACGGGGCAAGGGG - Intronic
1162872618 19:13598004-13598026 CATTTGCAGGAGAGGAAGTGGGG - Intronic
1163220754 19:15918201-15918223 CACTTGTAAGTGAGGACATGTGG - Intronic
1163511781 19:17739727-17739749 CACTTTTAAGAGAGGGAGTCAGG - Intergenic
1166025965 19:40084939-40084961 TATTTGTGAGAGAGTGTGTGTGG - Intronic
1167113361 19:47474713-47474735 CATTTGTAGCAGAGGGTCTGAGG - Intergenic
1167557037 19:50203271-50203293 CCTTTGTAAGGGCCGGCGTGGGG - Intronic
1202699783 1_KI270712v1_random:155515-155537 CACTTATAAGAGAGGACATGAGG + Intergenic
928346896 2:30507538-30507560 CATTTATAAGTGAGAGCATGTGG + Intronic
931243612 2:60474978-60475000 CATTTGGAAGGGAGGGAGAGAGG + Intronic
931929859 2:67119603-67119625 CATTTGTAAGTGAGAACATGTGG - Intergenic
932972756 2:76565131-76565153 CATTTCAAAGAGAAGGAGTGGGG + Intergenic
934170724 2:89538999-89539021 CACTTATAAGAGAGGACATGAGG + Intergenic
934281028 2:91613319-91613341 CACTTATAAGAGAGGACATGAGG + Intergenic
934611410 2:95739657-95739679 CAGGTGCAAGAGAGGGAGTGTGG - Intergenic
934922939 2:98360185-98360207 CATTTGTAAGAGAGGGAGGGGGG + Intronic
934989022 2:98908334-98908356 CATGTGCAAGAGAGGCGGTGTGG - Intronic
936048797 2:109207055-109207077 CATTTGGAGGAGAGGGCCTGGGG + Intronic
937824505 2:126352768-126352790 CATTTGTAAGTGAGGATGTGTGG - Intergenic
938175165 2:129119270-129119292 CATTTGTAAGTGAGAACATGTGG + Intergenic
938623421 2:133082112-133082134 TATTTGTAAGTGAGAGCATGTGG + Intronic
939206513 2:139112004-139112026 CATTTGTAAGACAGGTCCAGTGG + Intergenic
943244842 2:185433542-185433564 CATTTGTAAGTGAGAACATGTGG + Intergenic
943642297 2:190372976-190372998 CATGTGTAAGTGAGGCCGTGTGG + Intergenic
943669321 2:190644659-190644681 CACTTGTAAGTGAGAGCATGAGG - Intergenic
944202992 2:197127894-197127916 CACTTGTAAGTGAGGACGTGCGG + Intronic
944406729 2:199393118-199393140 CATTTGTAGCAGAGGGTGGGTGG - Intronic
945308056 2:208278634-208278656 CACTTGTAAGTGAGAGCTTGCGG + Intronic
945328113 2:208506682-208506704 CACTTGTAAGTGAGAACGTGTGG + Intronic
947336991 2:229097252-229097274 CATATGTAAGACGGGGCGAGGGG - Intronic
948326845 2:237128823-237128845 TATTTGTGAGAGTGAGCGTGAGG + Intergenic
949068858 2:242011262-242011284 CAATGGAAAGAAAGGGCGTGGGG + Intergenic
1173059604 20:39648682-39648704 CACTTGTAAGTGAGGTCATGTGG - Intergenic
1177048373 21:16200479-16200501 CATTTGTAAGTGAGAACATGTGG + Intergenic
1177149322 21:17438860-17438882 CATCTGGAAGGGAGGGCTTGGGG - Intergenic
1178034033 21:28560878-28560900 CATTTATAAGAGAGAACATGTGG - Intergenic
1178099247 21:29249386-29249408 CACTTGTAAGTGAGAGCATGTGG + Intronic
1179449776 21:41460462-41460484 CATTTATAAGAGAGGATGTCCGG + Intergenic
1181761396 22:25061144-25061166 TATTTGTAAAAAAGAGCGTGGGG + Intronic
1182070971 22:27463389-27463411 CAGTTGTGACAGAGGCCGTGTGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1184228794 22:43146678-43146700 CACTTGTAAGTGAGGACATGCGG - Intergenic
1184878176 22:47288690-47288712 CACTTGTCAGGGAGGGGGTGTGG - Intergenic
1185016685 22:48347364-48347386 CATACGGCAGAGAGGGCGTGGGG - Intergenic
951016565 3:17739050-17739072 CATTTGACGGAGAGGGCCTGTGG - Intronic
951798646 3:26570659-26570681 CACATGTAAGTGAGGTCGTGTGG + Intergenic
952206459 3:31185434-31185456 CATTTGTAAGAGGGAGCCAGAGG + Intergenic
953267415 3:41405205-41405227 CATTTATAAGTGAGAGCCTGAGG + Intronic
953317432 3:41941983-41942005 CATTTGGAAGAGTAGGCGTGGGG - Intronic
954353182 3:50062573-50062595 CATTTGTAAAAGAGAGAGTTGGG - Intronic
957520938 3:81317392-81317414 CATTTGGCAGAGAGGGAGTTGGG + Intergenic
958615420 3:96487855-96487877 CACTTATAAGTGAGGGCGTCTGG + Intergenic
959049793 3:101513578-101513600 AATATGTAAGAGAGGCTGTGAGG - Intergenic
959402522 3:105920806-105920828 CACTTATAAGTGAGGGCATGTGG + Intergenic
959495276 3:107043091-107043113 CATTTGTAAGTAAGAACGTGTGG - Intergenic
959582228 3:107993441-107993463 CATTAGTAACAGAAGGGGTGGGG - Intergenic
960347404 3:116550993-116551015 CACTTGTAAGAGAGAACATGTGG + Intronic
961473026 3:127129480-127129502 CATTTATAAGTGAGGGAGGGAGG + Intergenic
961790430 3:129372035-129372057 CATTTGTAAGTGAGAACGTGTGG + Intergenic
963496629 3:146071712-146071734 CATTTTTAAGAAAGGATGTGAGG - Intronic
963642028 3:147872803-147872825 CACTTGTAAGTGAGAACGTGTGG - Intergenic
967589788 3:191259743-191259765 CCTTTGTAAGAGATTGCCTGAGG - Intronic
969029064 4:4196877-4196899 CACTTATAAGAGAGGACATGTGG - Intronic
969397259 4:6930293-6930315 CATTTGAAAGTGTGGGAGTGAGG + Intronic
970704729 4:18786420-18786442 CACTTGTAAGTGAGAGCATGTGG - Intergenic
971069765 4:23078598-23078620 CATTTGTCTGAGAGGTGGTGAGG - Intergenic
972052393 4:34754594-34754616 ACTTTGTAAGAGAGGCCATGTGG - Intergenic
973561507 4:52141475-52141497 CATTTGTAAGTGAGAACATGTGG - Intergenic
974156083 4:58074653-58074675 CATTTGTAAGTGAGAACATGTGG - Intergenic
974233277 4:59145817-59145839 CACTTGTAAGTGAGAACGTGTGG + Intergenic
974738702 4:65976612-65976634 CATTTATAAGTGAGAGCATGCGG - Intergenic
975020929 4:69487507-69487529 CACTTATAAGTGAGGGCATGTGG - Intronic
979454756 4:120914917-120914939 CATTTGTAAGTGAGAATGTGTGG - Intronic
980144671 4:128967084-128967106 CACTTGTAAGTGAGGACATGCGG + Intronic
984787611 4:183583386-183583408 CACTTGTCAGAGAGGGCCAGTGG + Intergenic
984946312 4:184971348-184971370 CATTTTTACGAGTGGGAGTGAGG - Intergenic
985050526 4:185986639-185986661 CACTTGTAAGTGAGAACGTGTGG + Intergenic
985166303 4:187098655-187098677 CACTTGTAAGAGAGAACATGTGG + Intergenic
986347422 5:6847652-6847674 CACTTGTAAGTGAGGACATGTGG + Intergenic
987567136 5:19604267-19604289 CTTTTGTAAGATAGGGCCTTGGG - Intronic
987585284 5:19846795-19846817 CTTTTGTAAGACAGGTCTTGTGG + Intronic
989008081 5:36837794-36837816 CATTTGGAAAAGCGGGGGTGGGG - Intergenic
989558474 5:42824446-42824468 CATGTGTGAGAGAGGCCCTGAGG - Intronic
992248989 5:74858497-74858519 CATTTGTAAGTGAGAACATGTGG - Intronic
993876591 5:93314681-93314703 CATTTGTAAGGGAGAACATGTGG - Intergenic
994046147 5:95312742-95312764 CATTTATAAGAGAGAACATGTGG - Intergenic
994330547 5:98500510-98500532 CATTTATAAGAGTTGGCATGGGG + Intergenic
995025070 5:107410772-107410794 CAAATGTAAGAGAGGGAGTTAGG - Intronic
995166371 5:109047567-109047589 CATTTAGAAGAGAGGTTGTGTGG - Intronic
997249501 5:132377656-132377678 CATTTGTAAAACAGGGATTGGGG - Intronic
998357480 5:141552824-141552846 CATCTGCAAGAGAAGGCGAGAGG + Intronic
998778199 5:145627276-145627298 CATTTGTAAGTGAGAACATGTGG - Intronic
999182407 5:149679449-149679471 CATTTGGAAGAGATGGGGTGCGG - Intergenic
999526898 5:152416678-152416700 CATTTGTAAGTGAAAGCATGTGG - Intronic
1001434483 5:171688674-171688696 GATTTCTAAGAGTGAGCGTGTGG + Intergenic
1002773713 6:310785-310807 CATTTGTAAGAGATGACCTTAGG - Intronic
1004394421 6:15235585-15235607 CATTTGTAAGTCCGGGCCTGTGG + Intergenic
1005162579 6:22881302-22881324 AATTAGTAAGTGAGGGGGTGGGG - Intergenic
1006203464 6:32318213-32318235 CATTTGTAAGTGAGAACATGTGG - Intronic
1006955615 6:37868401-37868423 CATTTGTGATAGAGGGAGGGAGG + Intronic
1008202081 6:48603054-48603076 CCTTTGTAAGATAGAGCTTGTGG - Intergenic
1008522318 6:52374034-52374056 CAGGAGTAAGAGAGGGAGTGGGG - Intronic
1008637282 6:53423570-53423592 TATTTGTAAGAGAAGGAGTAAGG + Intergenic
1010127818 6:72454334-72454356 CATGTGAAAGAGAGGGGGTTGGG - Intergenic
1011571940 6:88747058-88747080 CATGTGTAAGAGAGTGCCTATGG - Intronic
1013846288 6:114456157-114456179 CATTTTTAAGATAGGGTTTGGGG - Intergenic
1014573785 6:123044936-123044958 CATTTGTAAGATGGGGCTTGTGG + Intronic
1014786236 6:125623220-125623242 CTTTTGTAAGAAAGGGAGTGAGG + Intergenic
1015228133 6:130882226-130882248 GATTTGTAACAGAAGGTGTGGGG - Intronic
1016093505 6:140007834-140007856 CATTTGTAAGTGAGAACATGTGG - Intergenic
1018754148 6:166834374-166834396 CATTTATAAGAGAGAACATGTGG - Intronic
1022422136 7:30233328-30233350 CCTTTGTAACAGAAGGTGTGGGG + Intergenic
1023159238 7:37281495-37281517 CATTTTCCAGAGAGGGCATGTGG - Intronic
1023742756 7:43295227-43295249 CTTTTGTGAGAGAGGGAGGGAGG + Intronic
1024795671 7:53016879-53016901 TATTTGTGAGAGGGGGCCTGTGG - Intergenic
1026622294 7:71960402-71960424 CATTTGTAAGTGAGAACATGTGG + Intronic
1028561609 7:92181913-92181935 CACTTATAAGTGAGGGCTTGCGG + Intergenic
1029866255 7:103633425-103633447 TATTTGTAAGAGAGAGGGGGCGG + Intronic
1029967761 7:104758118-104758140 CATTTGCAAGTGAGGACATGTGG - Intronic
1031889943 7:127282456-127282478 CATTTATAAGAGAGGACATGTGG - Intergenic
1032174257 7:129611291-129611313 CATTTCAAAGAGAGAGAGTGAGG + Intergenic
1032706953 7:134428816-134428838 CACTTGTAAGTGAGGGCATGTGG + Intergenic
1032787188 7:135210402-135210424 CATTTTTAAAAAAGGGGGTGGGG + Intronic
1033717309 7:144016120-144016142 CATTTATAAGTGAGAGCATGTGG - Intergenic
1037496742 8:19447742-19447764 GACTTGTCAGAGAGGGAGTGTGG + Intronic
1039876001 8:41586705-41586727 CATTCATAAGAGAGGTGGTGAGG - Intronic
1042057699 8:64783681-64783703 CATTTGTAATTGAGGACATGAGG - Intronic
1043079469 8:75747898-75747920 CATTTGTAAGTGAGAGCATGTGG - Intergenic
1043740611 8:83806645-83806667 CAGTTGAAAGAGAGAGTGTGGGG + Intergenic
1044781170 8:95744826-95744848 CACTGGTAAGTGATGGCGTGGGG - Intergenic
1045358856 8:101413695-101413717 CATTTGTTAGAGACGGGCTGTGG - Intergenic
1049157118 8:141073936-141073958 CATCTGGGAGAGAGTGCGTGGGG + Intergenic
1055589492 9:77796760-77796782 CATTGGTACCAGAGGACGTGGGG + Intronic
1059675076 9:116530263-116530285 CATTTGTAAGTGAGATCGTATGG - Intronic
1059759630 9:117325703-117325725 TATTTGTCTGGGAGGGCGTGAGG - Intronic
1185843960 X:3419614-3419636 CATTTATAAGTGAGAGCATGTGG + Intergenic
1186637836 X:11425836-11425858 CATTTGCAAGAGTGCGGGTGGGG - Intronic
1186921017 X:14280329-14280351 CATTTATAAGTGAGAACGTGTGG + Intergenic
1188669125 X:32861700-32861722 CCTTGGTAAGAGAGGGAGAGAGG - Intronic
1188701443 X:33269352-33269374 CATTTATAAGTGAGAGCATGTGG - Intronic
1191878698 X:65822858-65822880 CACTTATAAGTGAGGGCATGTGG - Intergenic
1193195230 X:78623749-78623771 CACTTGTAAGTGAGGACATGTGG - Intergenic
1193371045 X:80697550-80697572 CATTTGTAAGAGAGGGCGTGTGG + Intronic
1193674360 X:84431095-84431117 CACTTGTAAGTGAGGCCATGTGG + Intronic
1194116559 X:89906214-89906236 CACTTGTAAGTGAGAGCATGTGG - Intergenic
1196749338 X:119100725-119100747 GATTTGGAAGAGTGGGAGTGAGG - Intronic
1197408697 X:126088740-126088762 CACTTGTAAGTGAGAGCGGGCGG - Intergenic
1199397415 X:147355513-147355535 CATTTGTAAGTGAGGACATGTGG - Intergenic
1199742231 X:150746198-150746220 AATTTCTAAGTGAGGGCCTGAGG - Intronic
1200469358 Y:3563397-3563419 CACTTGTAAGTGAGAGCATGTGG - Intergenic
1200530788 Y:4334426-4334448 CATTTATAAGTGAGGACATGGGG - Intergenic