ID: 1193372104

View in Genome Browser
Species Human (GRCh38)
Location X:80711277-80711299
Sequence TAAGAGGCCTTCTGCAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193372102_1193372104 -10 Left 1193372102 X:80711264-80711286 CCAAATTTCTATCTAAGAGGCCT 0: 1
1: 2
2: 43
3: 218
4: 373
Right 1193372104 X:80711277-80711299 TAAGAGGCCTTCTGCAGAGGTGG 0: 1
1: 0
2: 2
3: 21
4: 227
1193372101_1193372104 -9 Left 1193372101 X:80711263-80711285 CCCAAATTTCTATCTAAGAGGCC 0: 1
1: 2
2: 44
3: 196
4: 422
Right 1193372104 X:80711277-80711299 TAAGAGGCCTTCTGCAGAGGTGG 0: 1
1: 0
2: 2
3: 21
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193372104 Original CRISPR TAAGAGGCCTTCTGCAGAGG TGG Intronic
901211656 1:7529926-7529948 TAAGAAGCTTCCTGCACAGGTGG + Intronic
901688435 1:10957619-10957641 GACAAGGCCTTCTTCAGAGGTGG - Exonic
902095243 1:13938713-13938735 GCAGAAGCCTGCTGCAGAGGTGG - Intergenic
906741671 1:48190840-48190862 TAATAGCCCTTCTGGACAGGAGG - Intergenic
906848783 1:49224716-49224738 TACAAGGCCTGCTGCAGAGCTGG - Intronic
907182095 1:52579633-52579655 TCAGAGGTTTTCAGCAGAGGAGG - Intergenic
907313141 1:53551397-53551419 ATGGAGGCCTTATGCAGAGGAGG + Intronic
907704342 1:56819750-56819772 TAAGTAGCCGTCTGCAGGGGCGG - Intergenic
908091030 1:60685906-60685928 GAAGAGGTGTGCTGCAGAGGAGG + Intergenic
912198519 1:107428559-107428581 TAAGAGACCTCTTCCAGAGGAGG + Intronic
915513852 1:156401472-156401494 TGTGAGGCCTTTTGCAGAGGAGG - Intergenic
915572409 1:156751690-156751712 GAAGAGGCCTCGCGCAGAGGAGG - Intronic
915777062 1:158501513-158501535 ACAGAGGCCTGCTGCAGGGGTGG - Intergenic
916463676 1:165050699-165050721 TAAGAGACCTTCAGAGGAGGTGG + Intergenic
916744258 1:167672090-167672112 CAAGAGGCCTTCTGAGCAGGAGG - Intronic
916819189 1:168381632-168381654 TATGAGGCCTTCAGCAGAAGTGG + Intergenic
918757679 1:188357949-188357971 ACAGAAGCCTGCTGCAGAGGTGG - Intergenic
920050736 1:203163288-203163310 AAAGAGACCTACTTCAGAGGGGG - Intronic
921051934 1:211517157-211517179 CAGGAGGGCTGCTGCAGAGGAGG + Intergenic
922060235 1:222082298-222082320 TAAGAGGAGTTCTCCAGAGTAGG - Intergenic
922801671 1:228367417-228367439 TAAGAGGCCATCTACAGAGTGGG - Intronic
922875301 1:228935756-228935778 TGAAAGCCCTGCTGCAGAGGAGG + Intergenic
924294919 1:242576988-242577010 TAGGAGGCAGTGTGCAGAGGGGG + Intergenic
924408771 1:243781434-243781456 GAAGAGGCATTCGACAGAGGAGG - Intronic
1063179554 10:3585491-3585513 TCAGTGACATTCTGCAGAGGGGG - Intergenic
1065248684 10:23786916-23786938 TCACAGGTCTTCTGTAGAGGAGG + Intronic
1066265763 10:33774396-33774418 GAAGTGGCCCTCTGCAGATGGGG - Intergenic
1069551451 10:69367205-69367227 TAGGAAGCATTCTCCAGAGGGGG - Intronic
1070786378 10:79164707-79164729 AAAGCTGCCTCCTGCAGAGGTGG + Intronic
1072698191 10:97619854-97619876 TAAGAGCACTTGGGCAGAGGTGG - Intronic
1073431151 10:103488122-103488144 TATGAGGCCTTGGGGAGAGGGGG - Intergenic
1075588236 10:123672616-123672638 GAAGAGAACTTCTGCAGTGGGGG + Intronic
1075614507 10:123881656-123881678 CAAGGGTTCTTCTGCAGAGGTGG + Intronic
1075714543 10:124548482-124548504 AGAGAGGCCTTCTGTCGAGGTGG + Intronic
1080525423 11:33111867-33111889 TGAGAGACCTTCTACAGAGCTGG + Intronic
1080655812 11:34257355-34257377 TTAGAGGCCTCCTGGAGATGTGG - Intronic
1081657619 11:44867937-44867959 TAAAAGGGTTTATGCAGAGGAGG + Intronic
1084772323 11:71351511-71351533 TATCAAGCCTTATGCAGAGGTGG - Intergenic
1087412388 11:97808478-97808500 GCAGAAGCCTGCTGCAGAGGTGG + Intergenic
1087539448 11:99496743-99496765 TAGGATGCCTTCTCAAGAGGTGG + Intronic
1087832307 11:102832363-102832385 AAAGAGGAATTCTTCAGAGGTGG - Intergenic
1090069423 11:123530696-123530718 TAAGAGGTCTGCTCCAGAGGAGG + Intronic
1090252385 11:125260870-125260892 AAAGAGGCCTTGTGGAGAAGTGG + Intronic
1090599597 11:128356776-128356798 AAAGAGGACTTCTGAACAGGAGG - Intergenic
1091286142 11:134409626-134409648 TGAGGGGCCTCCTGCAGGGGTGG + Intronic
1091461573 12:647128-647150 GAATATGCCTTCTGCAGGGGTGG - Intronic
1092213299 12:6662514-6662536 CAATAGGCTTTCTGCAGGGGTGG + Intronic
1093013763 12:14135756-14135778 AAAGAGGCCATCTGAAGAGAAGG + Intergenic
1094160723 12:27387223-27387245 TAAGAAGCCTTCTGCAGTCTAGG - Exonic
1094379853 12:29831093-29831115 GCAGAGGCCTACTGCAGGGGTGG - Intergenic
1094467059 12:30764515-30764537 TAAGACGCCTTGTTCAGATGGGG - Intergenic
1096113946 12:49044233-49044255 AAAGGGGCCTGCTGCACAGGCGG - Exonic
1099163065 12:79269453-79269475 TGAGAGAACTTATGCAGAGGTGG - Intronic
1105834010 13:24192815-24192837 AAAAAGGCCTTCTGCATGGGTGG + Intronic
1107938265 13:45363090-45363112 TAAAAGGCCACCAGCAGAGGGGG + Intergenic
1112011095 13:95294504-95294526 AAAGAGGCCTCCTGGAGAGGAGG - Intronic
1112199006 13:97257389-97257411 TAAGAGGCATACTGCTGAGTAGG - Intronic
1112574420 13:100622879-100622901 TAAAGGGACTTCTGCAGAGGGGG + Intronic
1113618449 13:111697172-111697194 AGAGAGGCCTTCTGCAGGGCTGG - Intergenic
1113618459 13:111697211-111697233 AGAGAGGCCTTCTGCAGGGCTGG - Intergenic
1113618477 13:111697280-111697302 AGAGAGGCCTTCTGCAGTGCTGG - Intergenic
1113623980 13:111782433-111782455 AGAGAGGCCTTCTGCAGTGCTGG - Intergenic
1113623988 13:111782472-111782494 AGAGAGGCCTTCTGCAGGGCTGG - Intergenic
1113624006 13:111782541-111782563 AGAGAGGCCTTCTGCAGTGCTGG - Intergenic
1114170818 14:20271053-20271075 GCAGAAGCCTGCTGCAGAGGTGG - Intronic
1115936593 14:38559633-38559655 GCAGAAGCCTGCTGCAGAGGTGG - Intergenic
1116172794 14:41424812-41424834 TAAGAGGCATTTACCAGAGGAGG + Intergenic
1117255395 14:53971957-53971979 TAAGAGGTCTGCTGCAGGGCTGG - Intergenic
1121181312 14:91931191-91931213 TAAGAAGCCTTCTGGGGTGGAGG - Intronic
1121507919 14:94490553-94490575 CATGAGGCCTCCTCCAGAGGAGG - Intronic
1122188339 14:100019510-100019532 TAAAAGGCTTTCTGCAGACAGGG - Intronic
1122396969 14:101440750-101440772 TAAGATGCCTTCGGCAGGGGAGG + Intergenic
1122626842 14:103089343-103089365 CAAGAGGCTTTGGGCAGAGGTGG - Intergenic
1122713839 14:103681293-103681315 TAAGACTCCATCTGAAGAGGGGG - Intronic
1123508392 15:20969746-20969768 TTAGTGGCCTTCTGCAGGGCAGG - Intergenic
1123565612 15:21543495-21543517 TTAGTGGCCTTCTGCAGGGCAGG - Intergenic
1123601876 15:21980782-21980804 TTAGTGGCCTTCTGCAGGGCAGG - Intergenic
1124466063 15:29941134-29941156 TAGGAGGTCATTTGCAGAGGTGG - Intronic
1124859442 15:33424475-33424497 TAAGAGGCCCTTTGCAGCGTAGG + Intronic
1127284487 15:57520624-57520646 TAAAGTGCCTTCTGCAGATGGGG + Intronic
1128393064 15:67196282-67196304 TAGGAGGACTGCTGCAGATGTGG - Intergenic
1128396828 15:67235113-67235135 TGAGAGGACTGCTGGAGAGGTGG - Intronic
1128433116 15:67618940-67618962 TAAGAGGTCATGAGCAGAGGGGG - Intronic
1128555469 15:68628842-68628864 CAAGAGGCTTTCTGCTGAGAGGG + Intronic
1128841264 15:70853560-70853582 GAAGAGGCCTCCTCCAGAGGAGG + Intronic
1130368284 15:83260625-83260647 ATAGAGGCCTTCTGTAGTGGAGG - Intronic
1131080633 15:89531704-89531726 TAGCAGGCCCTCTGAAGAGGAGG - Intergenic
1202973984 15_KI270727v1_random:270588-270610 TTAGTGGCCTTCTGCAGGGCAGG - Intergenic
1133175512 16:4011202-4011224 TGAAAGGCCCTCTACAGAGGTGG + Intronic
1137398746 16:48135902-48135924 TGAAAGGGCTTTTGCAGAGGAGG - Intronic
1139361784 16:66403959-66403981 TTCCAGGCCTTCTCCAGAGGGGG - Exonic
1139550895 16:67672494-67672516 TAAGAGCCCTCCTGCAGAGGTGG - Intergenic
1139712991 16:68790637-68790659 CATTAGGCCTCCTGCAGAGGCGG - Intronic
1139972157 16:70782958-70782980 GAAAGGGGCTTCTGCAGAGGTGG + Intronic
1140040893 16:71407049-71407071 GAAGAAGCTCTCTGCAGAGGTGG - Intergenic
1140311423 16:73852282-73852304 TAACAGGCCATCTGCAAATGAGG - Intergenic
1140654884 16:77130242-77130264 TATGTGGCTTTCAGCAGAGGAGG - Intergenic
1141238409 16:82242169-82242191 TAAGAAACCTACTGCAGAGGGGG - Intergenic
1141756514 16:85994948-85994970 CAAGAGGCCTTCAGCAGGGCTGG + Intergenic
1142310982 16:89313407-89313429 TGAGAGACCGTCTGCAGAAGGGG + Intronic
1142852045 17:2708986-2709008 AAGGAGGTCTTCTGCAGAGCGGG + Intronic
1146160894 17:30559112-30559134 TGAGATGCCTTCTGCTGATGGGG - Exonic
1146262701 17:31432141-31432163 AAGGAGGCTTTCTCCAGAGGCGG - Intronic
1146649406 17:34597525-34597547 TATGTGTCCTTCTGCAGATGCGG + Intronic
1147124015 17:38352946-38352968 CAAGAGGCCTTCTGGAGAGCTGG + Exonic
1147377948 17:40033926-40033948 TAAGAGGCCTTCAGCAGGGGAGG - Intronic
1148646584 17:49222890-49222912 CCAGAGGCCTGCTGCAGATGGGG + Exonic
1157477599 18:48033389-48033411 TAAGAGGACTGCTGCAGAAAGGG + Intronic
1158041288 18:53097749-53097771 AAGGTGGCCTTCTGCAGAAGAGG - Intronic
1158904768 18:62001261-62001283 GCAGAAGCCTTCTGCAGAGGTGG - Intergenic
1159244859 18:65792720-65792742 TAAGAGGGCTTCTGGAGACTGGG - Intronic
1163368190 19:16887947-16887969 TGAGGGGCCTTGTGCAGAAGAGG + Intergenic
1163725758 19:18922248-18922270 AAAGAGGCCTGCTTCAGGGGTGG + Intronic
1164566852 19:29331965-29331987 TAAGAGCCCCACTGCAGTGGTGG - Intergenic
1164908198 19:31984812-31984834 TCACAGCCCTTCTGCAGAGCTGG + Intergenic
1165936706 19:39393639-39393661 TAAGAAGCCTTCTGGACACGGGG + Intronic
1167429947 19:49448391-49448413 AATGAGGTCTTCTCCAGAGGTGG - Intronic
1168554026 19:57323148-57323170 GAAGTGGCTTTCTGCATAGGAGG + Intronic
926150774 2:10424588-10424610 GAAGATGCCCTCTGAAGAGGTGG - Intronic
929844859 2:45513396-45513418 TAAGGGGCATTCTGGAGAAGAGG - Intronic
930837365 2:55808509-55808531 TAAGAAGCCTTCTGCAGTAGCGG + Intergenic
931109872 2:59098814-59098836 GCAGAGGTCTACTGCAGAGGTGG - Intergenic
931274159 2:60729472-60729494 TGAGAGACATTCTGAAGAGGTGG - Intergenic
931648491 2:64447504-64447526 GAAGAGGCATTGTGCAGGGGAGG + Intergenic
933228067 2:79773715-79773737 TGAGAGGCCTCATGCAAAGGTGG + Intronic
935706920 2:105865001-105865023 CAAGAGGCCTCCTGCTGGGGAGG - Intronic
936678148 2:114739256-114739278 TAAGAGGGCTTATGGATAGGTGG - Intronic
936989955 2:118352655-118352677 TAAGAGGCCTTCTGGCTAAGTGG + Intergenic
937124570 2:119465282-119465304 TGGGAGGCTTTCTGCAGAAGTGG - Intronic
937143910 2:119626260-119626282 TAAAAGGCACTCTGCAGATGGGG - Intronic
937342294 2:121099021-121099043 TAAGACGGCCTCTGGAGAGGAGG + Intergenic
937961701 2:127464959-127464981 GAAGAGGCCTCCAGCAGAGTGGG - Intronic
938074887 2:128326524-128326546 AAAGATGCCTCCTGCAGAAGAGG + Intergenic
938766754 2:134464790-134464812 CAAGAATCCATCTGCAGAGGTGG - Intronic
939417747 2:141923265-141923287 TATTAGGCCATCTGTAGAGGTGG - Intronic
941534056 2:166701598-166701620 TCAGAAGCCTTGTGGAGAGGAGG + Intergenic
942691601 2:178591003-178591025 TCACAGCCCTTCTGCAGATGTGG + Exonic
943664664 2:190596514-190596536 TCAGGGGCCCTCTGCAGAGCAGG + Intergenic
944491535 2:200262929-200262951 TATGAAGCCTGCTGCAGAGGTGG + Intergenic
947984729 2:234438414-234438436 TAGGCAGCCTTCAGCAGAGGAGG - Intergenic
948291556 2:236828826-236828848 TAAGAAGCCCTCTGCAAATGGGG - Intergenic
948292401 2:236835533-236835555 GAAGAAGCCTGCTGCAGGGGTGG - Intergenic
948386649 2:237584922-237584944 TGAGAGGCTGTCTGCAGAGGGGG - Intronic
949066232 2:241992223-241992245 TATGATGCCTTCTACAGAGCTGG - Intergenic
1170453550 20:16510833-16510855 TAAGTTGCCTTATACAGAGGTGG + Intronic
1171777294 20:29380964-29380986 GAAGAAGCATTCTGCAGGGGTGG - Intergenic
1174172920 20:48628193-48628215 CAACAGGGCTTCTGCAGACGGGG - Intronic
1175167543 20:57055423-57055445 CAGCAGGCCCTCTGCAGAGGGGG + Intergenic
1176061530 20:63174891-63174913 TGACAGGCCTCCCGCAGAGGAGG + Intergenic
1177890561 21:26799359-26799381 TAAGAGCCCTTCTCCAGAGAAGG - Intergenic
1178028491 21:28495958-28495980 TATGAGGCCTTCTGCTTATGAGG + Intergenic
1179723910 21:43331271-43331293 GGAAAGGCCTTCTGCAGAGCAGG - Intergenic
1180984013 22:19893498-19893520 TCCCAGGCCTGCTGCAGAGGAGG - Intronic
1183723941 22:39578185-39578207 GAGGAGGTCTTCTGCAGAGATGG - Intronic
1185015665 22:48341196-48341218 GAAGAGCCCTTCTGCAGGGCAGG + Intergenic
1185287708 22:50010050-50010072 TCAGAGGCCATCTGCAGGGTGGG - Intronic
950076028 3:10187957-10187979 TGAGAGGCCTACTCCAGAGAGGG + Intronic
950535137 3:13574288-13574310 TGAGAGGCCTTCTGCAGGTCAGG + Intronic
950803963 3:15580765-15580787 TAGGAGGCCTTGTGTAGAGGAGG - Intronic
955090824 3:55749082-55749104 CAAAAGGCCTTCTGCAGACTGGG - Intronic
955432075 3:58856496-58856518 TAAGTGGCCTACAGCAGAGAGGG - Intronic
959037338 3:101383328-101383350 AAAGAGGCCGGCTGCAGTGGGGG + Intronic
963477757 3:145828798-145828820 TAAGAATCCTTCTGCACAGCGGG + Intergenic
963777317 3:149452220-149452242 ACAGAAGCCTACTGCAGAGGTGG - Intergenic
965513213 3:169592313-169592335 GAAGAGGCCTTCTGGACTGGAGG - Intronic
967260223 3:187634576-187634598 GAGGAGGCCTGCTGCAGCGGTGG - Intergenic
969371040 4:6731829-6731851 AGGGAGGCCTTCTGCAGAGGGGG + Intergenic
969858847 4:10020409-10020431 TGAGGAGCCTGCTGCAGAGGAGG + Intronic
971346284 4:25814940-25814962 TGGGGAGCCTTCTGCAGAGGTGG - Intronic
974358886 4:60849717-60849739 TAAGGGGGCTTCTGCAGTGCTGG + Intergenic
975888386 4:78993386-78993408 TAAGAGGAATTCAACAGAGGAGG - Intergenic
978267053 4:106839368-106839390 GAAGAAGTCTTCTGCAGGGGTGG - Intergenic
978322695 4:107515715-107515737 GAAGAAGCCTGCTGCAGGGGTGG + Intergenic
979844576 4:125491252-125491274 TGGGAGGTCTTCTTCAGAGGAGG + Exonic
984252598 4:177352323-177352345 TCAGTGTCCTTCAGCAGAGGCGG + Intronic
985077598 4:186232147-186232169 GAAAACGCCTTCTTCAGAGGTGG + Exonic
985821514 5:2163909-2163931 CAAGAGGAGTTCTGCAGAGCAGG - Intergenic
986526915 5:8688790-8688812 CCCGAGGCCGTCTGCAGAGGTGG - Intergenic
986660091 5:10051826-10051848 ACAGAAGCCTGCTGCAGAGGTGG - Intergenic
986757463 5:10851608-10851630 TAAGATGCCTATTGCAGAGAAGG - Intergenic
986924590 5:12731441-12731463 GAAGAAGCCTGCTGCAGGGGCGG - Intergenic
987057597 5:14209863-14209885 TAGGAGGGCTTCTGCACAGAGGG + Intronic
991164295 5:63544430-63544452 CAAGGGGGCTTCTGCAGAGCTGG + Intergenic
992954216 5:81891057-81891079 GAAGAGGTCTGCTGCAGGGGTGG + Intergenic
993327787 5:86563910-86563932 CAAGAGAACTTCTGGAGAGGAGG + Intergenic
995738220 5:115326267-115326289 TGGGAGGACTGCTGCAGAGGTGG + Intergenic
996038680 5:118786751-118786773 CAAGAGGCCTTCTGCAGTAATGG + Intergenic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
1003209430 6:4047817-4047839 TAAGAGGCCTTCATAAGAGGAGG + Intronic
1003387050 6:5678541-5678563 TAAGAGGCTATCTGCAGCAGTGG - Intronic
1003487944 6:6595765-6595787 TCAGAGCCCTCCTGCACAGGAGG + Intronic
1004546449 6:16603100-16603122 TAGGAGGCCCTTAGCAGAGGTGG - Intronic
1004919974 6:20367202-20367224 GAAGAGGCCTACTACAGAGAGGG + Intergenic
1006948059 6:37798599-37798621 AAAGAGGGGTTCTGTAGAGGAGG + Intergenic
1012699788 6:102440527-102440549 TAAGATGTGTTCTGCACAGGAGG + Intergenic
1013051177 6:106536865-106536887 TATGAGGCCATCAGGAGAGGGGG - Intronic
1018278009 6:162153663-162153685 AAAGAGGCCCTCAGCAGAGGGGG + Intronic
1019147570 6:169984884-169984906 GAGGAGGCCTCCTGGAGAGGTGG - Intergenic
1022543869 7:31166901-31166923 TATCAGGCCTTCCGCAGAAGGGG - Intergenic
1022957893 7:35398402-35398424 GAAGGGGCCACCTGCAGAGGTGG - Intergenic
1023094874 7:36650292-36650314 TAAGAGGCCTTATTCCTAGGGGG + Intronic
1024162899 7:46697113-46697135 TAAAATACCTTCTTCAGAGGAGG + Exonic
1026292303 7:69018637-69018659 GCAGAAGCCTGCTGCAGAGGTGG - Intergenic
1028133661 7:87205139-87205161 TAAGCGGCATACAGCAGAGGGGG + Intronic
1028305307 7:89255883-89255905 AAATAGGCATTTTGCAGAGGGGG + Intronic
1029442802 7:100596565-100596587 TCAGGAGCCTTGTGCAGAGGAGG + Intronic
1029575167 7:101398756-101398778 TCAGAGGGCCGCTGCAGAGGAGG + Intronic
1030440145 7:109579190-109579212 TGAGAGGACTTCTACAGTGGTGG + Intergenic
1033805818 7:144953336-144953358 GAAGAAGCCTGCTGCAGGGGTGG - Intergenic
1034570117 7:151949196-151949218 TAAAAAGCCATCTGCAGAGCCGG - Intergenic
1035616848 8:1008676-1008698 TACCAGTCCTCCTGCAGAGGCGG - Intergenic
1037411369 8:18601855-18601877 TGAGAGGGCTGCTGCAGAGCAGG + Intronic
1038463262 8:27734882-27734904 AAAGAGGCATTTAGCAGAGGAGG + Exonic
1039689607 8:39850031-39850053 TAAAAGGTCTTCTGAAGAGCAGG + Intergenic
1039972341 8:42331017-42331039 TAGCAGGCCTTGTGCAGTGGGGG + Exonic
1044510410 8:93070923-93070945 GAAGAGCCCTTCTGAAGAAGGGG - Intergenic
1045877462 8:106999209-106999231 TAAGAGACCTTCAGCAGAGAAGG + Intergenic
1046339078 8:112827833-112827855 AAAGAGGCCCTCTCCATAGGAGG + Intronic
1046815946 8:118583729-118583751 TAAAAGGCTTTCTGAAGAAGAGG - Intronic
1047224150 8:122942612-122942634 GCAGAGGCCTCCTGCAGTGGAGG - Intronic
1049811982 8:144579760-144579782 CCAGGGGCTTTCTGCAGAGGTGG - Intronic
1050053730 9:1630356-1630378 GAACATGCATTCTGCAGAGGAGG - Intergenic
1051988961 9:23127525-23127547 GAAGAGTAGTTCTGCAGAGGTGG + Intergenic
1052100945 9:24445703-24445725 CAAGATGGCTTCTCCAGAGGAGG - Intergenic
1053459236 9:38255778-38255800 AAAAAGGCCTTCTCCAGATGTGG - Intergenic
1056299317 9:85225653-85225675 TATGAGGCCCTCTGAAGATGAGG + Intergenic
1056994560 9:91443815-91443837 TAAGAGACCAGCTGCAGTGGGGG - Intergenic
1061014108 9:127972105-127972127 GAAGAGGCCCTCTGCACAGCCGG - Intronic
1061865048 9:133487833-133487855 TTAGAGGCGTCGTGCAGAGGGGG + Intergenic
1062252739 9:135606440-135606462 TAAGGGGCCTTCTGCAGGCCAGG - Intergenic
1062543385 9:137051391-137051413 CAAGAGGCCTTCTCCCCAGGTGG + Intronic
1185708691 X:2284725-2284747 TAATAGACCTCCTGCAGAGCCGG - Intronic
1187107504 X:16259303-16259325 TGAGAGGAGTTCTGCAGAGTGGG + Intergenic
1189571144 X:42298903-42298925 TAGGAGGGCTGCTCCAGAGGAGG + Intergenic
1189871994 X:45393782-45393804 GCAGAAGCCTGCTGCAGAGGTGG - Intergenic
1189993419 X:46615591-46615613 CATGGGGCCTTCTGGAGAGGAGG - Intronic
1193026324 X:76849771-76849793 GCAGAGGCCTGCTGCAGAGGTGG - Intergenic
1193372104 X:80711277-80711299 TAAGAGGCCTTCTGCAGAGGTGG + Intronic
1193413809 X:81197626-81197648 AAAGAGTGCTTCTGCTGAGGGGG + Intronic
1194350005 X:92815090-92815112 TAAGAGCCTTTCTGCAGAAATGG + Intergenic
1195604924 X:106794564-106794586 TAAAAGGCCTCCTGAAGAAGTGG - Intronic
1195626316 X:107008280-107008302 TGCGAGGCCTAGTGCAGAGGTGG - Intergenic
1195903591 X:109823046-109823068 AAACAGGCCCTCTGCAGTGGTGG - Intergenic
1195914915 X:109926661-109926683 TCTGATGCCTTCTACAGAGGTGG + Intergenic
1196028757 X:111072671-111072693 CAAAAGGCTTTATGCAGAGGAGG + Intronic
1196961241 X:121004496-121004518 AAAGAGGCAATCTGCAGAAGTGG + Intergenic
1197679197 X:129364086-129364108 GAAGAGGCCTTCTGCTGCAGTGG - Intergenic
1198077810 X:133211389-133211411 TAAAAAGCCTTCTTCTGAGGAGG - Intergenic
1200658324 Y:5931709-5931731 TAAGAGCCTTTCTGCAGAAACGG + Intergenic
1201864707 Y:18637459-18637481 TAAGGTGACTTCTGCAGACGGGG + Intergenic
1201868615 Y:18682919-18682941 TAAGGTGACTTCTGCAGACGGGG - Intergenic