ID: 1193374183

View in Genome Browser
Species Human (GRCh38)
Location X:80738607-80738629
Sequence TGCTGTGCACACAGTGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193374183 Original CRISPR TGCTGTGCACACAGTGGAGG GGG Intronic
900127060 1:1073366-1073388 TGATGTGCACAGTGTGGGGGTGG + Intronic
900220263 1:1504865-1504887 TGCACTGCTCACAGTGGTGGTGG + Intergenic
900592241 1:3465300-3465322 TGCTGGGAGCACAGAGGAGGGGG + Intronic
900707653 1:4090468-4090490 TGCTGTGAACCCACTGGTGGAGG - Intergenic
900917894 1:5651169-5651191 TTCTGGGCACACAGGGAAGGAGG + Intergenic
902051933 1:13570591-13570613 TGCTGTTCACACAGTGAAAAAGG + Intergenic
902763224 1:18597940-18597962 GGCAGGGCAGACAGTGGAGGTGG + Intergenic
904081665 1:27876321-27876343 GCCTGTGAACTCAGTGGAGGAGG + Intronic
904289867 1:29478245-29478267 TGCGATGGACACAGCGGAGGGGG - Intergenic
904674167 1:32188031-32188053 TGCTGTGCTCACCGCGCAGGTGG - Exonic
905196743 1:36285557-36285579 TTCTGTGCACACCGGGGTGGGGG + Intronic
905695383 1:39969704-39969726 TGCTGTGCTCACTGTGGGGCCGG + Exonic
905763703 1:40582418-40582440 TGGAGTGCACACAATAGAGGGGG + Intergenic
905952140 1:41960821-41960843 TTTTCTGCCCACAGTGGAGGGGG - Intronic
906153250 1:43599984-43600006 TGCTGTACACACTGTGCAGAGGG + Intronic
907266657 1:53265893-53265915 AGCTCTTCACACACTGGAGGAGG - Intronic
907579412 1:55558202-55558224 TGCTGTGAAGACAGAGGAGGAGG - Intergenic
912252624 1:108026988-108027010 TGCTCTGCCCACAGTGGGGGTGG + Intergenic
912706548 1:111919319-111919341 TGGTGGGCACACAGCTGAGGTGG + Intronic
915648343 1:157289787-157289809 TGCTGACCACACAGGTGAGGTGG + Intergenic
915819736 1:159009474-159009496 TCCTGTGCACAGAGTGGCAGTGG - Intronic
916674395 1:167053926-167053948 TGCTGGGCACACAGGTGAGCAGG + Exonic
917671787 1:177280445-177280467 TGCTTTCCCCACAGTAGAGGAGG - Exonic
917858408 1:179121591-179121613 TGCTGTGAAAACATTGAAGGTGG - Exonic
918543642 1:185658407-185658429 TACAGTGGACACAGTGGAGATGG - Intergenic
919780619 1:201218518-201218540 GGCTGTTCACAGAGAGGAGGTGG + Exonic
919814876 1:201431079-201431101 GGCTGGGCACAGGGTGGAGGGGG - Intergenic
921999112 1:221456124-221456146 TGATGTGCACACAGAGGATATGG + Intergenic
922324700 1:224517220-224517242 TGCTGAGCACACCTTGGAGCAGG + Intronic
922346552 1:224701164-224701186 TGCTATGCAGAGAGTGGAAGGGG + Intronic
922421454 1:225463423-225463445 AGCTGAGAACACAGTGGAAGGGG + Intergenic
922950572 1:229555556-229555578 TTCTGTTCACACAGTTTAGGAGG + Intronic
923006668 1:230055367-230055389 TGCAGTGCACACAGTCCAGAGGG - Intergenic
923315698 1:232778062-232778084 TGCTGGGCACACAGTGAGTGGGG + Intergenic
923829515 1:237539536-237539558 TACTGTGCAGCCAGTGGAGCCGG + Intronic
923834171 1:237591230-237591252 TCCTTTGCACAAAGAGGAGGAGG - Intronic
924060658 1:240170715-240170737 TGCTGTGAACACTGTCAAGGTGG + Intronic
924137386 1:240983690-240983712 TACTGTGAACTCAGTGGACGAGG - Intronic
1063122291 10:3113557-3113579 GGCTGTGAGCACAGTGGACGTGG + Intronic
1063904017 10:10764808-10764830 TACTCAGCAGACAGTGGAGGTGG - Intergenic
1064171521 10:13037916-13037938 TGCTGGTTCCACAGTGGAGGAGG + Intronic
1064653028 10:17528412-17528434 TTCAATGAACACAGTGGAGGGGG - Intergenic
1064715419 10:18171894-18171916 TGCTCTGCACATAGTGGGGTGGG - Intronic
1065181210 10:23128240-23128262 TGTGGTGCACACAGTGGAAGTGG - Intergenic
1069586026 10:69602985-69603007 TGCAGTGCACCAGGTGGAGGAGG - Intergenic
1069799308 10:71072392-71072414 TGCTGTCCAGACAGTGGAAGGGG + Intergenic
1069800232 10:71077376-71077398 AGCAGTGCACACATAGGAGGAGG + Intergenic
1071033989 10:81220763-81220785 TGCTGTGGCCAAAGTGGAGAGGG + Intergenic
1071510082 10:86255931-86255953 TGTTGTGCACACCATGGGGGAGG - Intronic
1071760833 10:88604497-88604519 TGATGTGTTGACAGTGGAGGTGG + Intronic
1072303003 10:94079904-94079926 TGCAGAGGACACAGTGGAGAAGG - Intronic
1072417380 10:95260534-95260556 CCCAGTGCACACAGTGGAGGGGG - Intronic
1072548903 10:96461978-96462000 TGCTGTGAACACCGTGTGGGTGG - Intronic
1073347881 10:102798357-102798379 TGCTCAGCACACAATGGAGAGGG - Intronic
1073588423 10:104732961-104732983 GGCTGAGCAAACAGTGGAGGTGG + Intronic
1073759832 10:106617298-106617320 TGCTGTGCAGAGAGAGGAGGAGG - Intronic
1074658662 10:115624691-115624713 AGCTGTCCAAACAGTGGGGGAGG - Intronic
1074872579 10:117588683-117588705 TCCTGTGCACACTGTGTATGGGG + Intergenic
1076422548 10:130341452-130341474 TGCTTTGCACACAGAGGACCTGG - Intergenic
1076627624 10:131831710-131831732 TGCTGTGCTAACAGGGGACGAGG + Intergenic
1076854815 10:133110940-133110962 GGCTGTGCTCACATTGGAGCAGG - Intronic
1077178678 11:1202771-1202793 AGCTGCGCCCAGAGTGGAGGCGG + Intergenic
1077189880 11:1251480-1251502 AGCTGTTCCCAGAGTGGAGGAGG - Exonic
1077825890 11:5808003-5808025 TACTGTGGAGACAGTGAAGGAGG - Intronic
1077867952 11:6238865-6238887 TGCTGTGGAAAGAGGGGAGGAGG + Intronic
1078509384 11:11974201-11974223 AGCTCTGCACACTGTGCAGGAGG + Intronic
1079562236 11:21836272-21836294 TGCTGTGACCACAGTAGAGATGG + Intergenic
1081592882 11:44437240-44437262 AGCTGAGCACACAGAGGAGGTGG - Intergenic
1081741064 11:45441000-45441022 GGCTGTGCCCACAGGGGTGGGGG - Intergenic
1081935929 11:46903966-46903988 TGCTGGGCACGCTGGGGAGGGGG - Intronic
1083612773 11:64012001-64012023 TGATTGGAACACAGTGGAGGTGG - Intronic
1084154444 11:67305692-67305714 TGCTGGACACACACTGGGGGAGG + Intronic
1084177320 11:67429670-67429692 AGCAGGGAACACAGTGGAGGAGG + Intronic
1085313017 11:75527051-75527073 TCCTGTGCACACACTGAAGACGG - Intergenic
1085396985 11:76211353-76211375 TGTTCTGGACACAGGGGAGGGGG + Intergenic
1085565652 11:77511188-77511210 AGCTCTGCACACAGGGAAGGGGG + Intergenic
1087012190 11:93524749-93524771 GCCAGTGCACACAGAGGAGGTGG + Intronic
1087990130 11:104739184-104739206 TCCTGAGCACACGGTTGAGGAGG + Intergenic
1089875963 11:121722601-121722623 TGCTGTGCAAACAGAGCACGTGG + Intergenic
1090684553 11:129100797-129100819 TACTGTGCACACAGTTGTGCTGG - Intronic
1092180555 12:6443894-6443916 TGCTGAGGAAAGAGTGGAGGAGG + Intergenic
1092314715 12:7398311-7398333 GACTGTGAACACAGTGGATGGGG - Exonic
1093525787 12:20102386-20102408 GGCTGTGCACACACTTGGGGTGG - Intergenic
1093916492 12:24808106-24808128 TCCTCTCCACCCAGTGGAGGTGG - Intergenic
1093958550 12:25250025-25250047 TGCTGTGGCCACAAAGGAGGAGG - Intronic
1095928495 12:47603362-47603384 TGCTGTGAGCACAGTGGTGCTGG - Intergenic
1096192126 12:49626588-49626610 TTCTGTGCAAAGAGAGGAGGAGG + Intronic
1096415333 12:51407719-51407741 AGCTGAGCACCCAGTGGAAGTGG - Intronic
1096967682 12:55641436-55641458 TGGTCTGTACCCAGTGGAGGTGG - Intergenic
1099892048 12:88601785-88601807 TGCAGAGCACATAGTGGATGTGG + Intergenic
1102440355 12:112959095-112959117 TGCTGTGCTAACAGTGAATGAGG + Intronic
1103554612 12:121758579-121758601 TGCTGTGGTCACCATGGAGGAGG + Intronic
1103554671 12:121758801-121758823 TGCTGTGGTCACCATGGAGGAGG + Intronic
1103554689 12:121758875-121758897 TGCTGTGGTCACCATGGAGGAGG + Intronic
1103554699 12:121758912-121758934 TGCTGTGGTCACCATGGAGGAGG + Intronic
1103582745 12:121927697-121927719 TGCTGTGGACACAGGAGAGATGG - Intronic
1103716257 12:122947148-122947170 TGCAGTGCACACAGAGGTGGGGG + Intronic
1105698576 13:22915688-22915710 TGCGGTGCAGACAGAGCAGGGGG - Intergenic
1108452409 13:50580365-50580387 TGTTGTCCAATCAGTGGAGGTGG - Intronic
1113338138 13:109396426-109396448 TGCTGTGACCACAGGGCAGGAGG + Intergenic
1113834658 13:113320679-113320701 TGCTGTGCCCACAGTTGGAGTGG + Intronic
1113963630 13:114139550-114139572 GGGTGTAGACACAGTGGAGGTGG + Intergenic
1115762958 14:36594000-36594022 AGCTGTGCACTCAGTGGAAGAGG - Intergenic
1117598812 14:57352547-57352569 GCTTGTGCACGCAGTGGAGGTGG - Intergenic
1118359598 14:65044775-65044797 TGCCCTGCACCCAGAGGAGGTGG - Intronic
1119044569 14:71307021-71307043 ATCTGAGCACACAGGGGAGGAGG + Intergenic
1119499278 14:75109702-75109724 TGCTGTGGTCACAGTGGAGAAGG - Exonic
1121520286 14:94581454-94581476 GAGTGTGCACACAGTGGAGGTGG - Exonic
1121913894 14:97818663-97818685 GGATGTGCACTCAGTTGAGGTGG + Intergenic
1122285443 14:100649049-100649071 TGTTGGACACACAGTGGTGGTGG - Intergenic
1122609442 14:102971611-102971633 TGCAGTCCACACAGGGCAGGTGG - Intronic
1122825200 14:104367381-104367403 TGATCAGCACGCAGTGGAGGTGG - Intergenic
1123055705 14:105568647-105568669 TGCAGTGCACACATACGAGGAGG - Intergenic
1123080063 14:105688166-105688188 TGCAGTGCACACATACGAGGAGG - Intergenic
1123129977 14:105977152-105977174 TCTTGTGCACACTGGGGAGGGGG - Intergenic
1123215264 14:106803335-106803357 GGCTGTGCACAGAGTAGATGAGG + Intergenic
1123410386 15:20054103-20054125 TCCTGTGCACACTGGGGAGGGGG + Intergenic
1123519718 15:21060810-21060832 TCCTGTGCACACTGGGGAGGGGG + Intergenic
1123580163 15:21707644-21707666 TCTTGTGCACACTGGGGAGGGGG - Intergenic
1123616811 15:22150266-22150288 TCTTGTGCACACTGGGGAGGGGG - Intergenic
1123967651 15:25475027-25475049 TGCTCTAGACACAGTGGATGTGG - Intergenic
1124121869 15:26894709-26894731 TGCTGTGCGCTCACCGGAGGAGG + Intronic
1124395038 15:29293803-29293825 TGGTGTGCAGGCAGTGGAGCGGG - Intronic
1126782535 15:52150818-52150840 TGCTGGGCAGGCAGTGGAAGAGG + Intronic
1127089983 15:55457374-55457396 TGCTGTGGCCACAGTGGGGGTGG - Intronic
1127118965 15:55754790-55754812 TGCTTTGCACACAGCAGATGAGG + Intergenic
1128944186 15:71810372-71810394 AGCTGAGCACACAGGGCAGGAGG + Intronic
1129234836 15:74217859-74217881 TGCTGAGCACACAGTGGGTTTGG + Intergenic
1129255079 15:74329900-74329922 AGGTGTGGACACAGGGGAGGAGG - Intronic
1130955524 15:88624509-88624531 TCCTCTTCACACAGTAGAGGGGG + Intronic
1202989033 15_KI270727v1_random:441889-441911 TCTTGTGCACACTGGGGAGGGGG - Intergenic
1132457913 16:34217-34239 TGCTGGGCCCACTGTGGGGGTGG + Intergenic
1132810277 16:1793837-1793859 TGGGGTGCAGACAGTGCAGGGGG + Intronic
1132932083 16:2464025-2464047 TCCTGTGCACACAGCGGTGGCGG + Exonic
1133368410 16:5229205-5229227 AGCTTTGCTCACAGTGCAGGAGG + Intergenic
1134269910 16:12724158-12724180 TCCTGTGTTCACAGTGGTGGCGG + Intronic
1136104122 16:28016889-28016911 TGCTGTGGACATTGTGGGGGAGG - Intronic
1136568095 16:31081729-31081751 AGGTGGGCACACAGTGGAGGGGG + Intronic
1137388249 16:48059902-48059924 TCCTGTGCACATACAGGAGGAGG - Intergenic
1137744361 16:50809955-50809977 TGCTGTGTGGACAGAGGAGGTGG + Intergenic
1137973766 16:53012577-53012599 AAGTGTGCTCACAGTGGAGGTGG + Intergenic
1140069917 16:71640391-71640413 TGTGGTGCAGATAGTGGAGGTGG + Exonic
1140123593 16:72103299-72103321 TGCATTGCACCCAGTGGAGAAGG + Intronic
1141352898 16:83315435-83315457 TACTGTACACACAGTGGGGTTGG - Intronic
1141382728 16:83590298-83590320 TCATGTGCACACAGAGGTGGTGG + Intronic
1141642183 16:85347751-85347773 TGCTGTGGACATAGTGGCTGCGG + Intergenic
1141859161 16:86704733-86704755 AGCTGTTCACACAGCGGATGAGG + Intergenic
1143380892 17:6495751-6495773 TCCTGGACACACAGAGGAGGAGG + Intronic
1143465354 17:7132776-7132798 TCCAGTGCACCCAGTGGAGACGG - Intergenic
1143617867 17:8064295-8064317 TGGTGTGGACACAGTGGGGAGGG + Intergenic
1146884463 17:36461921-36461943 TGCTGGGCACACCGTGGGGAGGG - Intergenic
1148747969 17:49928975-49928997 TGCTGAGGACAGTGTGGAGGGGG - Intergenic
1152070061 17:78129913-78129935 TGCTGGGCACACAGTGGGCTGGG - Intronic
1152155281 17:78628984-78629006 AGCTGTGCACACTGGGCAGGTGG - Intergenic
1152321832 17:79612023-79612045 GGCTGAGGACACAGTGGAGTGGG + Intergenic
1152567267 17:81105896-81105918 GGCTGAGCACACAGTGGGAGCGG + Intronic
1152855795 17:82664051-82664073 TGCTGTGCCGACGGTGGTGGGGG + Intronic
1152855897 17:82664333-82664355 TGCTGTGCCGACGGTGGTGGTGG + Intronic
1152891129 17:82882276-82882298 TGCTGGGCACAGACTGAAGGAGG - Intronic
1155167437 18:23242671-23242693 TGATGTGAACACAGTGCAAGAGG - Intronic
1155239405 18:23851207-23851229 TGCTGTTGACACAGTGGTGACGG + Intronic
1156886478 18:42141284-42141306 TGCTGTGCATGGAGTGGAGAGGG - Intergenic
1157126302 18:44959686-44959708 TGCTGTGTTCTCAGTGGGGGAGG + Intronic
1161021069 19:2011811-2011833 TGCTGTTCACACAGTGGAGGTGG - Intronic
1161170356 19:2809609-2809631 TGCTGTGCAAACAGTGTGGCAGG - Intronic
1161527209 19:4763866-4763888 TGCTTTGGACACAGTGGGAGAGG - Intergenic
1161763314 19:6190314-6190336 GACTGTGCACCCAATGGAGGAGG - Intronic
1162492630 19:11002927-11002949 TTCTGTGCAAACAGTTGAGTGGG + Intronic
1163228068 19:15979106-15979128 TGCCGGGCACACAGTGGAGGAGG + Intergenic
1164471718 19:28541759-28541781 TGCTATGCACACAGTGTTTGAGG - Intergenic
1164760870 19:30727393-30727415 TGCTCTGCACACAGCTGAGGAGG - Intergenic
1165304393 19:34994793-34994815 TGCTGTGTGGACAGAGGAGGAGG + Intronic
1165417332 19:35702815-35702837 GGCTGAGCATACAGTCGAGGTGG + Intergenic
1166052793 19:40270346-40270368 TGTTGGGCACAGAGTGGAGTGGG + Intronic
1167009889 19:46800422-46800444 TGCTTGGGACACAGTGGAGGTGG - Intergenic
1168251701 19:55145813-55145835 GGGTGTGCAGACAGTGGGGGTGG - Intronic
925192369 2:1894847-1894869 TGCTGTGAGCACAGTGTAGCAGG - Intronic
925465621 2:4105372-4105394 AGCTGTGCACCCAGTGGAGCTGG + Intergenic
925571517 2:5317094-5317116 TGCTCTGTACACAGAGGAAGGGG + Intergenic
926166307 2:10523683-10523705 TGCTGGGCACACAGTGGGCAGGG + Intergenic
926401681 2:12503455-12503477 TGATGAGGACACAGTGCAGGTGG - Intergenic
927139363 2:20119175-20119197 GGGTGTGGACACAGAGGAGGTGG - Intergenic
927443069 2:23133398-23133420 TGCTGTTTACACAGTGTAGCTGG - Intergenic
927487036 2:23495649-23495671 AGCTGTGGGTACAGTGGAGGTGG - Intronic
927927671 2:27024910-27024932 AGCAGTGCAGACAGAGGAGGTGG - Intronic
928656084 2:33453040-33453062 TGCTGTGCACCCCTTGGGGGAGG + Intronic
928670505 2:33598997-33599019 AGCAGTGCAGACAGTGGACGTGG + Intronic
929050584 2:37833474-37833496 TTCTGTGCACACAGTGTTGCTGG + Intergenic
929544403 2:42846275-42846297 TGCTGTTCCCACAGTGGGAGGGG - Intergenic
930900857 2:56506352-56506374 TGTTTTGCATACAGAGGAGGAGG + Intergenic
931043626 2:58325717-58325739 TGCTGTGCTCACAATGAATGAGG - Intergenic
932584969 2:73022001-73022023 TGCTGTGCACATACAGAAGGTGG - Intronic
934776855 2:96944518-96944540 TCCTGAGAACACAGTGGTGGTGG + Intronic
937969877 2:127541289-127541311 TGCTGTCTCCACAGTGAAGGAGG + Intronic
938981334 2:136530104-136530126 AGCTTTGCAAACAATGGAGGTGG - Intergenic
942386027 2:175444045-175444067 TGCTTTGCCCACAGTGGAGTCGG - Intergenic
942699888 2:178693934-178693956 TGCTTCTCACACAGAGGAGGAGG - Exonic
944668522 2:201976223-201976245 TCCTGTACACACAGAGGATGGGG + Intergenic
946171756 2:217899803-217899825 AGCTGTCCACAGACTGGAGGTGG - Intronic
946442287 2:219706849-219706871 TGCAGTCCACAAAGTGGGGGAGG + Intergenic
946978100 2:225175561-225175583 TGCTATGCAAGCAATGGAGGAGG + Intergenic
948671513 2:239571559-239571581 TGCCGTGAACAGGGTGGAGGTGG + Intergenic
948861293 2:240753891-240753913 TGGTGTCCACACAGTTGAGCTGG - Intronic
1168916422 20:1491872-1491894 TGATGTGCAGAAAGTAGAGGAGG + Intergenic
1170257383 20:14360097-14360119 TGCTGGGCACAGGGTGGTGGGGG + Intronic
1175233699 20:57493457-57493479 TGCTGGTCACTCCGTGGAGGAGG + Intergenic
1176027289 20:62992554-62992576 TGCTGTGCACACAGGTGACATGG - Intergenic
1176428624 21:6563277-6563299 GTCTTTGCACCCAGTGGAGGAGG + Intergenic
1179704114 21:43171593-43171615 GTCTTTGCACCCAGTGGAGGAGG + Intronic
1179724456 21:43334026-43334048 GGCTGTGCACTCAGGGCAGGAGG + Intergenic
1180258739 21:46651541-46651563 TCCAGTGCAGGCAGTGGAGGGGG + Intronic
1180945001 22:19687990-19688012 CCCTGTGCACACTGTGGAGCTGG + Intergenic
1182436929 22:30336862-30336884 TTCTGAGCACACAGTGAATGTGG - Intronic
1182470918 22:30547713-30547735 TGCTGTGCACACAATTCAGAAGG + Intergenic
1182722429 22:32414318-32414340 TGATAAGCAGACAGTGGAGGGGG - Exonic
1183060933 22:35335971-35335993 TGCTCTTCACACAGGGAAGGGGG + Intronic
1183208173 22:36433477-36433499 GGCTGTGGGCCCAGTGGAGGTGG - Intergenic
1183254119 22:36749985-36750007 TACTGTGCTCACAGTCCAGGGGG - Intergenic
1183307669 22:37091425-37091447 TGCTGGGCCCCCAGGGGAGGGGG + Intronic
1183745858 22:39691289-39691311 TGCTGGGGACACAGTGGTGATGG + Intergenic
1184406544 22:44303876-44303898 TGCTCTGCAGATGGTGGAGGTGG - Intronic
1184822015 22:46916521-46916543 TGCTGTGCACACAGGCGTGCAGG + Intronic
1185067564 22:48639783-48639805 TGCTGTGGACTGAGTAGAGGTGG - Intronic
951011115 3:17681003-17681025 TGCTGTCCACAAAATGGATGAGG + Intronic
951162433 3:19441073-19441095 TGCTGTTCCCTCAGTGGAGGCGG + Intronic
951856354 3:27201568-27201590 TGTTTTGCAGATAGTGGAGGCGG - Intronic
952549874 3:34464624-34464646 TGCCATGCAGACAGTGGAGCAGG + Intergenic
952553003 3:34500351-34500373 TGTGGTAAACACAGTGGAGGAGG + Intergenic
954317620 3:49809869-49809891 TGCCGGGCCCACTGTGGAGGAGG + Exonic
954600339 3:51862800-51862822 TGATGTGCCCACAGTGGCAGAGG + Intronic
954652985 3:52176476-52176498 TCCTGTAGCCACAGTGGAGGAGG - Intergenic
955203742 3:56876436-56876458 TGGTCTGCCAACAGTGGAGGAGG - Intronic
955387812 3:58492793-58492815 TGCTGGGCTGACAGTGGTGGAGG + Intronic
955738670 3:62066585-62066607 CGCCTTGGACACAGTGGAGGGGG - Intronic
955953486 3:64265097-64265119 TGCTGGTCACACAGAGGAGCAGG + Intronic
961081926 3:124034262-124034284 TGATGTGCACAGAGGGGCGGCGG + Intergenic
961447208 3:126986455-126986477 TGCTGTGCACACACTGGGCAGGG + Intergenic
961671151 3:128532487-128532509 AGCTGAGCACTCAGTGGAGAGGG + Intergenic
966981112 3:185136572-185136594 AGCTGGGCCCACAGTGGTGGCGG + Intronic
967538972 3:190642288-190642310 AGCTGCGCACTCAGTGGAAGAGG + Intronic
968866287 4:3214101-3214123 TGAAGTGCACACAGTAGATGAGG - Exonic
969462188 4:7334651-7334673 CGCTGAGGACACAGGGGAGGTGG + Intronic
970092649 4:12427604-12427626 TGCTATGCATACAGCGGAAGGGG - Intergenic
970345305 4:15147380-15147402 TGCTGTGCACAGAGGAGAGGAGG - Intergenic
972602096 4:40581875-40581897 CGCTGCTCACAGAGTGGAGGAGG - Intronic
975219658 4:71799586-71799608 AGCTGAGTACTCAGTGGAGGGGG - Intronic
975244737 4:72107038-72107060 TCCTGGGCACACTGTGGTGGGGG - Intronic
977013533 4:91663385-91663407 TTGTGTGCAGACACTGGAGGTGG + Intergenic
977648118 4:99437711-99437733 TGGTGTGCACAGAATTGAGGGGG + Intergenic
978352768 4:107837668-107837690 TGCTGGGCAGAGAGTGGAGTAGG + Intronic
978622037 4:110642072-110642094 GTGTGTGCACACAGTGGAGAGGG - Intronic
979161670 4:117469207-117469229 TGCTGTGAACAATGTGGATGTGG + Intergenic
980582538 4:134773328-134773350 TGCTGTGCACTCCATGGAGTTGG + Intergenic
981280039 4:142946515-142946537 TGCTGTGCACAGAGGAGATGAGG - Intergenic
984066417 4:175053741-175053763 TGGGGTTTACACAGTGGAGGAGG - Intergenic
984634162 4:182092955-182092977 TTCTGGGCACACAGTGGACAAGG - Intergenic
985641529 5:1065566-1065588 TGCTGGGTCCACAGGGGAGGTGG - Intronic
985845066 5:2338427-2338449 TGCTCTGAACACAGTGGGGATGG + Intergenic
986327149 5:6684879-6684901 TGCTCTGAACACAGTGGAGCAGG - Intergenic
992066621 5:73115628-73115650 TGCTGTGGCCACTGTTGAGGGGG + Intergenic
993094870 5:83470749-83470771 TGCTGTTTACACAGTGGGGTGGG + Intergenic
994324424 5:98432990-98433012 TGCTGTGACCACACTGGATGAGG + Intergenic
994993580 5:107030515-107030537 TGCTTTGTACACAGTAGATGTGG - Intergenic
998470883 5:142382831-142382853 GGCTGAGCAAAGAGTGGAGGAGG - Intergenic
998612131 5:143700727-143700749 TGATGGGTACACTGTGGAGGGGG + Intergenic
1001651733 5:173320617-173320639 TGCTGTGCAGAAAGTGGGGCGGG + Intronic
1001832303 5:174799095-174799117 TCCTGTGCTCCCAGAGGAGGGGG - Intergenic
1002187773 5:177462526-177462548 TGCGTTGCTCACAGCGGAGGGGG - Intronic
1003242026 6:4353306-4353328 TGCTGTCATGACAGTGGAGGAGG - Intergenic
1006983981 6:38165978-38166000 TGCTGTGCAGAGGGGGGAGGTGG - Intergenic
1006984065 6:38166245-38166267 TGCTGTGCGCAGGGGGGAGGTGG - Intergenic
1007231032 6:40347909-40347931 TGCTGGGGAGTCAGTGGAGGAGG - Intergenic
1008169593 6:48186802-48186824 TGCCCTGCACACACTGGATGTGG + Intergenic
1010090761 6:71978112-71978134 TTCTGTGCACTAAGGGGAGGAGG + Intronic
1013165566 6:107588318-107588340 AACTGTGCAGACTGTGGAGGGGG - Intronic
1013512877 6:110859813-110859835 TACTGAGGCCACAGTGGAGGGGG - Intronic
1014506709 6:122268572-122268594 TGCTGTGGTCACAGGGGAGTTGG - Intergenic
1015760202 6:136650486-136650508 TGCTGTGCACAAAGTGAGGTGGG - Intronic
1016683394 6:146855633-146855655 TGCTGTGCACACAGAGCATATGG - Intergenic
1017153268 6:151300347-151300369 TGCAGTTCACACAGTAGACGAGG - Intronic
1018182963 6:161240646-161240668 TGCGGTGCCCACAGAGGAGAGGG + Intronic
1018191424 6:161312274-161312296 TGCTGTTCATACAGTGGAAAGGG - Intergenic
1018491127 6:164294565-164294587 GGCTGTTCACACAGTGGAGAGGG + Intergenic
1019323293 7:425221-425243 GGCTGGGCACACAGTGAAAGGGG - Intergenic
1019420379 7:948027-948049 TGCTGGGTCCTCAGTGGAGGAGG - Intronic
1019486214 7:1290587-1290609 AGCTGTGCACACTGTGAAGTAGG - Intergenic
1021660308 7:22913400-22913422 GGGTGTGCACACAGTGAAGTCGG - Intergenic
1021863080 7:24926607-24926629 TGCTGTGCCCACAGTAAGGGTGG - Intronic
1022927029 7:35066895-35066917 ACCAGTGCACACAGTGGAGAGGG - Intergenic
1023618960 7:42050023-42050045 CGCTGTGCACTTAGTGGAGCTGG - Intronic
1026439984 7:70435793-70435815 TGCTGTGCCCACAATGGGGGAGG - Intronic
1026947371 7:74325163-74325185 TGCTGCCCACCCAGTGGAGAGGG + Intronic
1029952693 7:104603834-104603856 TGCTGGGCACACTGGGGTGGGGG + Intronic
1032454470 7:132062987-132063009 TGCTGTGGATTCAGAGGAGGAGG + Intergenic
1033145254 7:138865660-138865682 TGCTCTGCACCCACAGGAGGAGG + Intronic
1034876976 7:154733149-154733171 TGCTGGCCACCCAGTGAAGGTGG - Intronic
1035712481 8:1729313-1729335 TGCTGTGCAGAGAGTGGGGAAGG - Intergenic
1036407521 8:8468440-8468462 TGCTGGGAACACAGGGGAGCAGG - Intergenic
1036484138 8:9164362-9164384 TGCTATAAACACAGTGGAGGTGG + Intronic
1039736317 8:40336660-40336682 TGCTGAGTAGACAGTGGAGGAGG + Intergenic
1040439809 8:47429361-47429383 TGCTGTGCACACGGAGGTGGGGG - Intronic
1041706330 8:60850096-60850118 TGCTATTCACAGAGTGGATGGGG + Intronic
1045187260 8:99851695-99851717 TGTTGTGGGCCCAGTGGAGGGGG + Intronic
1048209182 8:132440706-132440728 AACTGTGCACACACAGGAGGGGG + Intronic
1049161876 8:141103101-141103123 TGCTGGGCACAGCTTGGAGGTGG + Intergenic
1049444490 8:142623760-142623782 TGCTGAGATCACAGAGGAGGGGG + Intergenic
1049783228 8:144438552-144438574 GGCTGTGCCCACAGTGGAACCGG - Exonic
1051919991 9:22253523-22253545 GCCTGTGCACGCAGTGGAAGTGG - Intergenic
1052807604 9:33026036-33026058 GTCTGGGCACACAGTGGTGGGGG - Intronic
1055762551 9:79624392-79624414 TTCAGAGCACACAGGGGAGGAGG + Intronic
1056124478 9:83521698-83521720 GACTGTGCAGACAGTGGAGTGGG - Intronic
1056275550 9:84991341-84991363 TGCTGGGCACCCCGTGGATGTGG + Intronic
1057023044 9:91715364-91715386 TGGTGTGCCCACGATGGAGGCGG + Intronic
1057793666 9:98140761-98140783 AGCTCTGCAAACAGAGGAGGTGG + Intronic
1057796418 9:98161174-98161196 TGGTGTGGCCACAGAGGAGGAGG + Intronic
1061069874 9:128302753-128302775 TTCTGTCCACGGAGTGGAGGAGG + Intergenic
1061725047 9:132577698-132577720 TGCTCTGCAAACAGTGGAGTTGG - Intergenic
1061821430 9:133228963-133228985 TGATGTGCACACCGTCAAGGGGG + Intergenic
1062266395 9:135688306-135688328 TGGCTTGAACACAGTGGAGGTGG + Intergenic
1062619642 9:137414319-137414341 GTCTGTGCACACAGTGGGGCAGG - Intronic
1186935629 X:14448049-14448071 TGCTTTGCACACAATAGATGGGG - Intergenic
1187857596 X:23652124-23652146 TCCTGTGCACACAGCAGATGTGG - Intergenic
1188309108 X:28595874-28595896 TACTCTGCACACTGTGGAGCTGG - Intronic
1191062773 X:56317529-56317551 TGCAATGCACACTGTTGAGGAGG - Intergenic
1193248449 X:79259126-79259148 TGGTAAGCACAAAGTGGAGGAGG + Intergenic
1193312773 X:80026612-80026634 TTGTGTGCACATGGTGGAGGTGG + Intronic
1193374183 X:80738607-80738629 TGCTGTGCACACAGTGGAGGGGG + Intronic
1200041719 X:153375684-153375706 TTCTGTGCACACAAAGGAGGGGG + Intergenic
1200391390 X:155950202-155950224 TGCTCTGCTCACACTGGAGTTGG + Intergenic
1200763315 Y:7059457-7059479 TCCTGTTCATACAGTGGAAGGGG - Intronic
1200769194 Y:7107969-7107991 TCCTGTTCATACAGTGGAAGGGG + Intergenic
1201405489 Y:13645619-13645641 TACTGTGTCCACAGAGGAGGAGG + Intergenic