ID: 1193375943

View in Genome Browser
Species Human (GRCh38)
Location X:80761425-80761447
Sequence CACTGAAGCAATTATATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193375942_1193375943 -9 Left 1193375942 X:80761411-80761433 CCTATGCTGAAACACACTGAAGC No data
Right 1193375943 X:80761425-80761447 CACTGAAGCAATTATATGACAGG No data
1193375940_1193375943 2 Left 1193375940 X:80761400-80761422 CCCACAAGAAGCCTATGCTGAAA No data
Right 1193375943 X:80761425-80761447 CACTGAAGCAATTATATGACAGG No data
1193375939_1193375943 16 Left 1193375939 X:80761386-80761408 CCAAAATAAAAAGACCCACAAGA No data
Right 1193375943 X:80761425-80761447 CACTGAAGCAATTATATGACAGG No data
1193375941_1193375943 1 Left 1193375941 X:80761401-80761423 CCACAAGAAGCCTATGCTGAAAC No data
Right 1193375943 X:80761425-80761447 CACTGAAGCAATTATATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193375943 Original CRISPR CACTGAAGCAATTATATGAC AGG Intronic