ID: 1193377008

View in Genome Browser
Species Human (GRCh38)
Location X:80773349-80773371
Sequence TAGGTTGAAATGACAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 319}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193377008_1193377013 2 Left 1193377008 X:80773349-80773371 CCCACCTCTGTCATTTCAACCTA 0: 1
1: 0
2: 1
3: 24
4: 319
Right 1193377013 X:80773374-80773396 AATATCCTTTTTATTCTTGGAGG 0: 1
1: 0
2: 3
3: 46
4: 465
1193377008_1193377015 8 Left 1193377008 X:80773349-80773371 CCCACCTCTGTCATTTCAACCTA 0: 1
1: 0
2: 1
3: 24
4: 319
Right 1193377015 X:80773380-80773402 CTTTTTATTCTTGGAGGCATAGG 0: 1
1: 0
2: 1
3: 25
4: 335
1193377008_1193377012 -1 Left 1193377008 X:80773349-80773371 CCCACCTCTGTCATTTCAACCTA 0: 1
1: 0
2: 1
3: 24
4: 319
Right 1193377012 X:80773371-80773393 ATCAATATCCTTTTTATTCTTGG 0: 1
1: 0
2: 2
3: 40
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193377008 Original CRISPR TAGGTTGAAATGACAGAGGT GGG (reversed) Intronic
900973387 1:6003634-6003656 TAGGATAAAGTCACAGAGGTAGG + Intronic
901031791 1:6311394-6311416 TAGGCTGAAATGAGAGAGACAGG + Intronic
903440498 1:23384494-23384516 TAGGTCCAAATCCCAGAGGTTGG + Intronic
906521116 1:46467474-46467496 TAGGTGGAAAAGACTGAGGCAGG + Intergenic
906983251 1:50654490-50654512 TGAGTGGAAATGACAGAGATAGG + Intronic
907127556 1:52064555-52064577 TGTGTTGAAATGACAAAGGCTGG + Intronic
908450847 1:64252913-64252935 ATGGTTGAATTGACAGAAGTAGG + Intronic
909227229 1:73041453-73041475 TACTTTGAAATGACAGAATTTGG + Intergenic
910341782 1:86196677-86196699 TAGGTTGATTTGACCAAGGTTGG + Intergenic
910642138 1:89474383-89474405 ATGGCTGAAATGACAGAAGTAGG + Intergenic
911148946 1:94579125-94579147 ATGGCTGAAATGACAGAAGTAGG - Intergenic
911242903 1:95484319-95484341 ACGGATGAACTGACAGAGGTAGG + Intergenic
911674993 1:100648251-100648273 CTGGCTGAAATGACAGAGTTAGG + Intergenic
911728568 1:101268000-101268022 TTGCTGGAAATGTCAGAGGTGGG + Intergenic
911776184 1:101815684-101815706 TCGGATGAAATGACTGAGGGAGG + Intronic
911794640 1:102059781-102059803 ATGGCTGAAATGACAGAAGTAGG + Intergenic
911922674 1:103786110-103786132 TAAGTGGAAATGAGAGAGATTGG - Intergenic
912143688 1:106764245-106764267 TAGGTTGAAATTAAAGAGAAAGG + Intergenic
913179334 1:116305593-116305615 TAGGTTGAAAATAGAAAGGTAGG - Intergenic
914886329 1:151587348-151587370 AAGATTCAAATGACAGTGGTGGG - Intergenic
915719402 1:157973254-157973276 TATGTTGAAATGTTAGAGGCCGG - Intergenic
915822126 1:159035305-159035327 TAGGTTGCAATGACTGAGCAAGG - Intronic
915990749 1:160513013-160513035 AAGGATGAACTGACAGAAGTAGG + Intronic
916594646 1:166232619-166232641 ATGGCTGAAATGACAGATGTAGG - Intergenic
917023247 1:170613518-170613540 TTTGATGAAATGACAGAAGTGGG - Intergenic
917204018 1:172549959-172549981 TAGGTTTAAAAGACAGACTTTGG - Intronic
917424658 1:174901662-174901684 ATGGCTGAAATGACAGAAGTAGG - Intronic
917459881 1:175220901-175220923 TAGGTTTACATGAAAGTGGTGGG + Intergenic
920838557 1:209534609-209534631 GTGGGTGAAAGGACAGAGGTGGG + Intergenic
921028260 1:211310383-211310405 TAGGTTGGAATATCTGAGGTTGG + Intronic
921502361 1:215921210-215921232 TAGGTAAATATGACAGAAGTTGG + Intronic
922212895 1:223499048-223499070 CATGTTGAAATGATAGAGGTGGG + Intergenic
923352744 1:233125554-233125576 TTGGTTGAAATTCCAGGGGTGGG + Intronic
924729523 1:246698641-246698663 GATGTTGATATGAAAGAGGTTGG - Intergenic
924828894 1:247572191-247572213 TATGTCAAATTGACAGAGGTGGG - Intronic
924919486 1:248612548-248612570 ATGGTTGAAATGACAGAAATAGG + Intergenic
1063331671 10:5165737-5165759 TAGCTTGAAAAGACAGAGATGGG + Intergenic
1063880487 10:10526664-10526686 GAGTTGGAAGTGACAGAGGTTGG - Intergenic
1064132293 10:12720834-12720856 AAGGCTGAAATGACTGAGGGAGG - Intronic
1064316369 10:14261597-14261619 CAGGTTGAAATCAGATAGGTTGG - Intronic
1064534183 10:16341866-16341888 GATGCTGAAGTGACAGAGGTGGG - Intergenic
1065643927 10:27814883-27814905 GAGGTTGAACTGATAGAGGATGG - Intronic
1066509641 10:36082563-36082585 ATGGCTGAAATGACAGAAGTAGG - Intergenic
1067245212 10:44535673-44535695 AAAGTGGAAATGACAGAGGTTGG - Intergenic
1068798757 10:61115111-61115133 CAGGCTGAAAAGAGAGAGGTTGG - Intergenic
1068810967 10:61255953-61255975 ATGGCTGAAATGACAGAAGTAGG - Intergenic
1071154144 10:82670164-82670186 TGGGAAGAAATGACAGAGGGAGG - Intronic
1071263282 10:83940519-83940541 GAGGTTGTTAAGACAGAGGTTGG + Intergenic
1072176173 10:92924077-92924099 TAGGGAGTAATGACATAGGTAGG + Intronic
1072370076 10:94757419-94757441 TTTGATGAACTGACAGAGGTAGG - Intronic
1075165651 10:120065891-120065913 TAAGTTAAAAGGACAGATGTGGG - Intergenic
1075852122 10:125597778-125597800 TAGGTCCAAATGACAATGGTTGG + Intronic
1077863136 11:6200478-6200500 TAGGTTGAAATAATGGAGGTGGG - Intergenic
1078459998 11:11507449-11507471 TAGGAGGAAAAGAAAGAGGTGGG - Intronic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1082746399 11:56967993-56968015 ATGGTTGAATTGACAGAAGTAGG - Intergenic
1083523266 11:63336310-63336332 TCGGATGAACTGACAGATGTAGG - Intronic
1083631741 11:64098921-64098943 AAGGTTGAAATGAAACAGGAGGG + Intronic
1083786458 11:64951416-64951438 TAGGGTGAAATGACAAGGCTGGG - Intronic
1085061106 11:73447884-73447906 TAGTTTGAAATGACAAAATTAGG - Intronic
1086422042 11:86646200-86646222 GAGTTTGAATTGACAGAAGTAGG + Intronic
1086741802 11:90378808-90378830 ATGGATGAAATGACAGAAGTAGG - Intergenic
1086789614 11:91019054-91019076 TTTGTTGAATTGACAGAAGTAGG - Intergenic
1086800602 11:91170107-91170129 ATGGATGAAATGACAGAAGTAGG + Intergenic
1087053790 11:93911682-93911704 AAGGTTGAAAGTACAGAGCTGGG + Intergenic
1088169786 11:106982810-106982832 AGGGATGAAATTACAGAGGTAGG + Intronic
1090443401 11:126743131-126743153 TAGGTTGAAATTAGAGTAGTTGG + Intronic
1090498632 11:127239889-127239911 TAGGTGGAAATGTGAGAGATTGG + Intergenic
1091511443 12:1131260-1131282 GAGGAGGAAATGACAGAGGATGG + Intronic
1092940270 12:13401460-13401482 AAGTATGAAATGACAGAGGCTGG - Intergenic
1093775255 12:23066246-23066268 TGGGTTGGAATGACTCAGGTTGG - Intergenic
1098674157 12:73267348-73267370 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1101326936 12:103723892-103723914 TAAGTTGAAATGATAAAAGTTGG + Intronic
1104169118 12:126262849-126262871 TAGGTTAAAAGGACAAAGGGAGG + Intergenic
1105549922 13:21384117-21384139 TGAATTGAGATGACAGAGGTGGG + Intronic
1105931903 13:25060452-25060474 TAGATTGCACTGACAGAGGGTGG - Intergenic
1106122288 13:26870616-26870638 TAGGTAGAAATAACAGAAGCAGG - Intergenic
1106378679 13:29215353-29215375 TATGATGAATTGACAGAAGTAGG - Intronic
1107456444 13:40559971-40559993 TAGGTTGACATGACCGAATTAGG + Exonic
1109361585 13:61300305-61300327 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1109528954 13:63614845-63614867 TAGGTTGAAGTTACTTAGGTGGG + Intergenic
1109735602 13:66480415-66480437 TATGTTGAAATAACAGTGGCAGG + Intronic
1110294279 13:73843723-73843745 TAGGTATAAGTGACAGAGCTAGG + Intronic
1110942155 13:81363675-81363697 TTTGTTGAATTGACAGAAGTAGG + Intergenic
1111889167 13:94060135-94060157 TAGGTTAAAATCACAGTGTTGGG - Intronic
1112161972 13:96877627-96877649 TAGAATGAAATGGCAGAGGAAGG - Intergenic
1113574809 13:111387824-111387846 TTGCTTGAAATAACAGATGTAGG + Intergenic
1113960636 13:114123858-114123880 TAGGATAAAATTCCAGAGGTTGG - Intronic
1115316541 14:32030645-32030667 GAGGTGGAAATGCCAGAGCTAGG + Intergenic
1115466926 14:33725593-33725615 TATGGTGACATGAGAGAGGTAGG - Intronic
1115474817 14:33802763-33802785 TAGGGTGACATTACAGAGGAAGG - Intronic
1116099213 14:40410697-40410719 TAATTTGAAATGACAGAGTGAGG + Intergenic
1116123855 14:40756447-40756469 GTGGTTGAATTGACAGAAGTAGG - Intergenic
1116470106 14:45276894-45276916 TTTGTTGAAAGGACTGAGGTAGG + Intergenic
1119099821 14:71869456-71869478 TATGTTGAAATGACAGTAATTGG + Intergenic
1119327395 14:73768994-73769016 AGGGATGAAATGACAGAGGCTGG - Intronic
1120325742 14:83023451-83023473 AATGTTGAACTGGCAGAGGTGGG - Intergenic
1120396331 14:83971439-83971461 TAGGTTGAAAAGAAGGAGGAAGG + Intergenic
1120428288 14:84379035-84379057 TAGTTTGAAAAGACAGAAATTGG + Intergenic
1120638006 14:86974975-86974997 AAGGCTGAAATGACAGAAATAGG + Intergenic
1121930808 14:97970594-97970616 AAGGGTGAAATAATAGAGGTAGG + Intronic
1124805678 15:32879798-32879820 TAAGTTTCAATGACAGAGGCTGG - Intronic
1126278526 15:46914794-46914816 TATGCTGTAAAGACAGAGGTTGG - Intergenic
1126545594 15:49870826-49870848 TAGACTGAAATGACAGAAGCTGG + Intronic
1127100025 15:55554522-55554544 TTGGCTGAACTGACAGAGGTAGG + Intronic
1127989991 15:64106967-64106989 TAGGGAGAAATGAGTGAGGTGGG - Intronic
1129610970 15:77056634-77056656 TTGGTAGAAATGACAGAGCTTGG + Intronic
1129881375 15:79008701-79008723 GAGGTTGAAATGACAGAAAATGG + Intronic
1131411703 15:92213017-92213039 TAGGGTGAAATTACACAGATGGG - Intergenic
1132858292 16:2057355-2057377 TCTGTTGAACTGACAGAGGAAGG - Intronic
1134095618 16:11416631-11416653 TGTGTTCAAATGACAGAGCTGGG + Intronic
1134358366 16:13505982-13506004 TAGGTACAGATGACAGAGTTAGG - Intergenic
1134607361 16:15581696-15581718 GAGGTTGGGAGGACAGAGGTTGG - Intronic
1136925685 16:34371479-34371501 ATGGCTGAAATGACAGAGGATGG + Intergenic
1136978889 16:35040327-35040349 ATGGCTGAAATGACAGAGGATGG - Intergenic
1140211316 16:72972812-72972834 AATGTAGAGATGACAGAGGTGGG - Intronic
1141791738 16:86241543-86241565 TCAGTGGAAATGACAGAGTTGGG - Intergenic
1143885330 17:10060906-10060928 TGGGTTGTCATGACGGAGGTGGG + Intronic
1144012675 17:11164372-11164394 GAGATTGAATTGACAGAAGTAGG + Intergenic
1144131160 17:12249100-12249122 TGTGTTGAAAAGACAGAGATGGG + Intergenic
1144159860 17:12547276-12547298 TTTGTGGAAATGACAGAGTTTGG - Intergenic
1144835231 17:18153380-18153402 TAGGATGAAATGGGAGAGGCAGG - Intronic
1147512657 17:41084615-41084637 CAGGTGGAGATGACACAGGTTGG - Exonic
1147514351 17:41101752-41101774 CAGGTGGAGATGACACAGGTTGG + Exonic
1147516566 17:41123554-41123576 CAGGTGGAGATGACACAGGTTGG + Exonic
1147517930 17:41139907-41139929 CAGGTGGAAATGACACAGGTTGG + Exonic
1147518869 17:41149259-41149281 CAGGTGGAGATGACACAGGTTGG + Exonic
1150498899 17:65631046-65631068 AAGGTTGAAATGGTAGAGTTTGG + Intronic
1153679314 18:7485252-7485274 AAGGTTCAGATGAGAGAGGTCGG - Intergenic
1156778595 18:40822800-40822822 TTGGATGAATTGACAGAAGTAGG + Intergenic
1157189529 18:45569038-45569060 TAGGGAGAAATGGGAGAGGTGGG - Intronic
1158444251 18:57505044-57505066 TAGGTTGAAAGCACAGAAGTAGG - Intergenic
1158842324 18:61401046-61401068 TAGTTTGATATGCCAGAGGTAGG - Intronic
1159235881 18:65672217-65672239 ATGGATGAAATGACAGAAGTAGG + Intergenic
1160300661 18:77674747-77674769 TAGGGTGATAGGACAGGGGTGGG - Intergenic
1162307896 19:9886547-9886569 TAGGTGGAAATGACAGAACTCGG - Intronic
1165254466 19:34567206-34567228 TTTGATGAATTGACAGAGGTAGG - Intergenic
1167224651 19:48229613-48229635 TAGGCTGGAAGGACAGAAGTGGG + Intronic
925809097 2:7681133-7681155 TAGGTTGAAAGTACAGAATTAGG + Intergenic
926290356 2:11524352-11524374 TTGGGTGACATGACAGAGGGAGG + Intergenic
929589786 2:43137456-43137478 TAAGATGAAATCACAGAGGCTGG - Intergenic
929724735 2:44413281-44413303 TAGGGTCAAATGAAAGAGGCAGG + Intronic
931382989 2:61770702-61770724 TAGTTGGCAATGACAGAAGTAGG - Intergenic
931489403 2:62727211-62727233 AAGGTGGAAAGGACAGAGTTGGG - Intronic
931565792 2:63614517-63614539 TACTTTGAAATGAAAGAGGCTGG + Intronic
932008265 2:67949382-67949404 CAGGTTTAACTGACAGAGGTTGG - Intergenic
932355330 2:71063816-71063838 TAGCTTGAAATCACCGTGGTGGG - Intergenic
935929837 2:108112691-108112713 TTGGATGAATTGACAGAAGTAGG - Intergenic
937335023 2:121057215-121057237 TAGGATGAAATGACAAAGCCTGG - Intergenic
937389228 2:121468839-121468861 ATGGCTGAAATGACAGAAGTAGG - Intronic
939413966 2:141868299-141868321 ATGGTTGAAATTACAGAAGTGGG - Intronic
939908520 2:147950300-147950322 TAGGCAGTAATGACAGAAGTTGG + Intronic
941240948 2:163037038-163037060 ATGGCTGAAATGACAGAAGTAGG + Intergenic
941913265 2:170787726-170787748 TGGGTTGAAATAACATAGTTTGG - Intronic
941945258 2:171089259-171089281 TACGTTGAAATGACACAGTAAGG - Intronic
942407344 2:175669467-175669489 TTTGATGAAATGACAGAAGTAGG + Intergenic
942581971 2:177429300-177429322 ATGGTTGAAATCACAGAAGTAGG - Intronic
943884646 2:193200250-193200272 TAGCTGGAAGTGACAGAGATGGG + Intergenic
945409313 2:209489441-209489463 TTTGATGAAATGACAGAAGTAGG + Intronic
945587794 2:211688347-211688369 CAGGTTGAGAAGACAGAGCTAGG - Intronic
945785841 2:214235861-214235883 TAGAATGAAATGATAGAGTTGGG - Intronic
946690712 2:222306526-222306548 TGGGGCGAAATGACAGAGGGAGG + Intergenic
946982295 2:225230604-225230626 TAGTTTCAAATGACAGAGGCTGG + Intergenic
948741535 2:240050239-240050261 CAGGTTGAAATGACAACCGTAGG + Intergenic
1169632017 20:7644453-7644475 TATGTTGAAAGAACATAGGTTGG + Intergenic
1170091830 20:12597576-12597598 AAGGTTGAAATACAAGAGGTGGG - Intergenic
1174810517 20:53641355-53641377 TATGTTGAAAGGACAGAACTTGG + Intergenic
1176059921 20:63168058-63168080 TGGCTGGAAAGGACAGAGGTAGG - Intergenic
1176523071 21:7839231-7839253 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1177050408 21:16225759-16225781 TTTGATGAATTGACAGAGGTAGG + Intergenic
1177303433 21:19281379-19281401 TAGGTTGAATTCACAGATGTGGG + Intergenic
1178024744 21:28453444-28453466 AAGGTAGAACTGAAAGAGGTTGG + Intergenic
1178049333 21:28731012-28731034 ATGGGTGAAATGACAGAGGATGG + Intergenic
1178657091 21:34469243-34469265 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1180580253 22:16828831-16828853 GAGGTTGAAATGGAAGAGGAGGG - Intergenic
1182729705 22:32477890-32477912 TAAGTTGTAGTGGCAGAGGTAGG + Intronic
1183942865 22:41306006-41306028 TAGGTTGAAAAGCCAGAGAAAGG + Intronic
1184529316 22:45044467-45044489 TAGTTTGCAAAGACAGAGGCTGG - Intergenic
949592833 3:5511361-5511383 ATGGATGAATTGACAGAGGTAGG + Intergenic
949683271 3:6540479-6540501 TGTGATGAATTGACAGAGGTAGG - Intergenic
949787587 3:7758877-7758899 TTGGTAGAATTGACATAGGTTGG - Intergenic
952389662 3:32869388-32869410 TAAGCTGAAAGGACAGAGGAAGG - Intronic
953525619 3:43687848-43687870 TAGGTTGCAATGACATGTGTTGG + Intronic
954856896 3:53651929-53651951 TAGGTTGAAAGGACCTAGGAAGG - Intronic
956965862 3:74459289-74459311 GAGGAAGAAGTGACAGAGGTTGG - Intronic
959785180 3:110288336-110288358 TAGGTTGAAATTAAAAAGATGGG - Intergenic
962351067 3:134656128-134656150 TAGGATGAAATGAAAGAGTAAGG + Intronic
963192317 3:142486483-142486505 TAAGCTGAAATGAGAGAGGGAGG - Intronic
963946871 3:151155447-151155469 GAGGGTGAAATCAGAGAGGTTGG - Intronic
964610893 3:158613768-158613790 CAGCCTGAAAAGACAGAGGTAGG - Intergenic
965659666 3:171028324-171028346 CAGGTTCAAAAGACAAAGGTTGG - Intergenic
966412326 3:179656563-179656585 CAGGATGAAATCAAAGAGGTAGG - Intronic
966652226 3:182314626-182314648 AAGGATGAACTGACAGAAGTAGG - Intergenic
967300818 3:188010373-188010395 TACGTTGAAATGTCAGGAGTGGG - Intergenic
967448399 3:189595739-189595761 TAGGTAGAGAAGACAGAGGTTGG + Intergenic
970952611 4:21774936-21774958 ATGGATGAAATGACAGAAGTAGG - Intronic
971771561 4:30904101-30904123 TAGATGGAAGTGACAGAGTTGGG - Intronic
972099927 4:35402227-35402249 TAGGTTGAAATCAGATAGTTTGG + Intergenic
972429139 4:38963853-38963875 TAGGATGAAAGTACAGAGTTTGG + Intergenic
973828521 4:54734519-54734541 TAGTTTGAAATGACAAAGAGGGG + Intronic
974456529 4:62135482-62135504 GAAGATGAAATGACAGAGGGTGG - Intergenic
975153611 4:71046241-71046263 ATGGTTGAATTGACAGAAGTAGG + Intergenic
976369353 4:84268993-84269015 TAGGAAGAAAGGAAAGAGGTGGG + Intergenic
976391385 4:84508182-84508204 TAGGTTTAAATGAAAGTGTTTGG + Intergenic
978237520 4:106477315-106477337 AAGGTTGAAATAAAAGAGATTGG - Intergenic
978642408 4:110886467-110886489 CAGGTTGATATGACAGAGTATGG - Intergenic
979819244 4:125150847-125150869 TTGGATGAATTGACAGAAGTAGG - Intergenic
979839365 4:125419057-125419079 TAGCTGGGAATGTCAGAGGTAGG - Intronic
979967234 4:127089352-127089374 ATGGATGAAATGACAGAAGTAGG + Intergenic
980562145 4:134491178-134491200 TAGGCTGAAATTAAAGAGGTGGG + Intergenic
981320832 4:143389212-143389234 TTGGTTAAAAAGACAGAGGAAGG - Intronic
983351992 4:166602049-166602071 AAGGTTGAACTGACAAAGGAAGG - Intergenic
983838906 4:172430331-172430353 TACAGTGAAATGACAGATGTGGG + Intronic
984162345 4:176268980-176269002 TATGTAGAAATGACTGAGGATGG + Exonic
986918705 5:12659500-12659522 TAGTTTGCAATGCCAGATGTAGG - Intergenic
986921220 5:12684520-12684542 TATGTTGCAATGACAGAGTTAGG + Intergenic
987906927 5:24089134-24089156 ATGGTTGCAATGACAGAAGTAGG + Intronic
987978400 5:25046180-25046202 CAGATTGAGCTGACAGAGGTTGG - Intergenic
988435081 5:31164553-31164575 TAGGTAGAAGGGAGAGAGGTAGG - Intergenic
988724066 5:33908274-33908296 TAGTTTGCAATGATGGAGGTGGG + Intergenic
989306660 5:39965566-39965588 TATTTTTAAATGACAGAGGAAGG - Intergenic
990615113 5:57499978-57500000 TTGGTTGTCATGACTGAGGTGGG - Intergenic
991570914 5:68052466-68052488 TAGGTGGCAAGGACAGAGGCAGG - Intergenic
993248378 5:85482492-85482514 TAGGATGAAAAGAAAGAAGTGGG + Intergenic
993410346 5:87566509-87566531 TTTGATGAAATGACAGAAGTAGG - Intergenic
994152544 5:96464623-96464645 TTGGTTGAAATGACAGAAAGAGG + Intergenic
995134243 5:108663177-108663199 TAGGAGGAAGTCACAGAGGTAGG + Intergenic
995151580 5:108853891-108853913 TAGTCTGAAATGAGAGAGGAAGG + Intronic
995322500 5:110852346-110852368 TGAGTTGAAATGGCAGAGGTTGG - Intergenic
995329602 5:110932788-110932810 ATGGTTGAAGTGACAGAAGTAGG - Intergenic
995620746 5:114022397-114022419 TTGGATGAATTGACAGAAGTAGG + Intergenic
996675834 5:126173079-126173101 ATGGATGAAATGACAGAAGTAGG + Intergenic
997864533 5:137449342-137449364 TAGGCTGAGAGGAGAGAGGTGGG - Intronic
998352015 5:141508105-141508127 TAGGTTAAGAGGACAGAGGGAGG + Intronic
1000267684 5:159653351-159653373 TGAGTTCTAATGACAGAGGTGGG + Intergenic
1000509782 5:162166184-162166206 ATGGCTGAAATGACAGAAGTGGG + Intergenic
1001330270 5:170757114-170757136 TAGTTCTAAATGACTGAGGTTGG + Intergenic
1001844163 5:174905545-174905567 ATGGCTGAAATGACAGAAGTTGG + Intergenic
1001877623 5:175215117-175215139 TAGCTCGAAATGGCAGAGCTGGG + Intergenic
1002449753 5:179311959-179311981 AAGGTAGAAATGACAGCAGTGGG + Intronic
1004973964 6:20944079-20944101 TGAGTTGAAGAGACAGAGGTTGG - Intronic
1005382846 6:25254870-25254892 TAGGATGAAATCCCAGAAGTTGG - Intergenic
1006411496 6:33876594-33876616 AAGCTTGAAATGATAGAGGCAGG + Intergenic
1006660941 6:35643721-35643743 AAGGTTGGTATGACAGAAGTAGG - Intronic
1007133827 6:39501479-39501501 ATGGCTGAAATGACAGAAGTAGG + Intronic
1007168509 6:39845973-39845995 AAGGGGGAAATGAGAGAGGTTGG + Intronic
1008004983 6:46401253-46401275 TAGGTTGGAAGGACAGAGGAGGG - Intronic
1010033109 6:71289695-71289717 TAGGTTGAAAGGCCTGAGTTGGG - Intronic
1010822549 6:80432669-80432691 TTGGATGAATTGACAGAAGTAGG - Intergenic
1011632916 6:89344928-89344950 AAGCTTGAAATGAGAGGGGTTGG - Intronic
1012561627 6:100588001-100588023 TAGGTGGAAAGCACTGAGGTGGG - Intronic
1012755156 6:103221168-103221190 TGAGTAGAAATGACAAAGGTGGG - Intergenic
1012783141 6:103589166-103589188 TAGTTTTAACTGAAAGAGGTAGG - Intergenic
1012869538 6:104657186-104657208 TAGGCTGAAATGACAGAAGTAGG + Intergenic
1013062502 6:106648888-106648910 TAGCTTGAATTGAAAAAGGTGGG - Intronic
1013379790 6:109556974-109556996 ATGGATGAACTGACAGAGGTAGG - Intronic
1014864148 6:126506709-126506731 ATGGATGAAATGACAGAAGTAGG + Intergenic
1015911800 6:138176101-138176123 TAGACTGAAAGTACAGAGGTGGG - Intronic
1016423669 6:143912253-143912275 ATGGTTGAAATGACAGAAGTAGG - Intronic
1016430617 6:143981489-143981511 TAGGTTGAGATGATGGAGTTAGG - Intronic
1016529152 6:145038781-145038803 TGGGTAGAAATGCTAGAGGTTGG + Intergenic
1017023642 6:150162353-150162375 CAGGAAGAAATGGCAGAGGTTGG - Intronic
1017601444 6:156087013-156087035 GAGCTTGAAAAGACACAGGTAGG + Intergenic
1017999908 6:159569878-159569900 TATGTTGAGATGAGAGGGGTGGG - Intergenic
1018716902 6:166540093-166540115 TAGCTGGAAGTGATAGAGGTGGG + Intronic
1020599058 7:10248984-10249006 TTGGATGAACTGACAGAAGTAGG + Intergenic
1020621918 7:10528758-10528780 TTGGATGAATTGACAGAAGTAGG + Intergenic
1021049908 7:15970354-15970376 TAGGTGGAAATGATACAGGAAGG + Intergenic
1021292494 7:18863744-18863766 GAGTTAGGAATGACAGAGGTGGG + Intronic
1021640342 7:22730270-22730292 TAAGTAGAAATGGCAGAGGCAGG - Intronic
1022869262 7:34458359-34458381 TTTGATGAATTGACAGAGGTAGG + Intergenic
1023210423 7:37798135-37798157 AAGGTTCAAATGGGAGAGGTGGG - Intronic
1023454557 7:40324072-40324094 TAGGTTCAAATGCAAGAGTTTGG - Intronic
1023491348 7:40745948-40745970 TAGGTTAAGGTGATAGAGGTTGG + Intronic
1024697674 7:51872915-51872937 AGGGCTGAAATGACAGAAGTAGG - Intergenic
1029620150 7:101685214-101685236 TATCTTGAAATGACAGGGCTTGG - Intergenic
1030198125 7:106873402-106873424 TTGGTTGAATTTACAGATGTAGG - Intronic
1031505743 7:122580155-122580177 TAGGTTCACATTACAGAGGGCGG + Intronic
1031847083 7:126818952-126818974 AAGGTGGAAGTGACAGGGGTTGG - Intronic
1033791633 7:144797633-144797655 ATGGATGAACTGACAGAGGTAGG + Intronic
1033977064 7:147115800-147115822 ATGGCTGAAATGACAGAAGTAGG - Intronic
1035326072 7:158066993-158067015 TAGGTTGAAAGGTTAGAGCTGGG + Intronic
1036466428 8:9002310-9002332 TGGGTTGAAAAGACAGAGATTGG - Exonic
1037185892 8:16063285-16063307 CATGTTGAAATGTGAGAGGTGGG - Intergenic
1038706852 8:29902202-29902224 ATGGATGAACTGACAGAGGTAGG + Intergenic
1040614058 8:49017524-49017546 ATGGATGAATTGACAGAGGTAGG - Intergenic
1041024849 8:53673501-53673523 TAAGTTGAAATAACAGATCTTGG + Intergenic
1041615433 8:59900400-59900422 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1041889922 8:62857829-62857851 GATGCTGAAATGACAGAAGTAGG - Intronic
1042473251 8:69215160-69215182 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1042489654 8:69382310-69382332 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1042675721 8:71319540-71319562 TAGGTAGAAGTCACAGAGATAGG - Intronic
1042759795 8:72257989-72258011 ATGGTTGAACTGACAGAAGTAGG + Intergenic
1043324712 8:79035073-79035095 AGGGCTGAAATGACAGGGGTAGG + Intergenic
1043522532 8:81061870-81061892 TAGGTTGAAAGCATAGAGGATGG - Intronic
1046088210 8:109465114-109465136 GAGTTTGTAATGACAGATGTGGG + Exonic
1046638753 8:116702358-116702380 TAGGTTGATATGATATATGTGGG - Intronic
1046728935 8:117704319-117704341 AAGGGTGAAATGAGAGAAGTAGG + Intergenic
1047269870 8:123346238-123346260 TTGGTCGAAAAGACATAGGTTGG + Exonic
1047374018 8:124279040-124279062 TCGGTGGAAATGACAGAGTCAGG + Intergenic
1048106391 8:131415013-131415035 TAGGATAAAATGGCAGAGGAAGG - Intergenic
1048324841 8:133430837-133430859 TTGGGTGAGATTACAGAGGTAGG - Intergenic
1050074960 9:1853717-1853739 CATGTTGAAATGTTAGAGGTGGG + Intergenic
1050490783 9:6185876-6185898 CAGGTTATAATGACAGAGCTTGG + Intergenic
1052176632 9:25471381-25471403 ATGGCTGAAATGACAGAAGTAGG - Intergenic
1053039278 9:34856263-34856285 AAGGCTGAAATGACAGAAGTAGG - Intergenic
1056100741 9:83298432-83298454 GAGGATGAGATGACAGAGTTTGG + Intronic
1057286312 9:93757582-93757604 TAGCTTCAGATGACACAGGTTGG + Intergenic
1057365324 9:94415030-94415052 TTATTTTAAATGACAGAGGTAGG + Intronic
1057657998 9:96973054-96973076 TTATTTTAAATGACAGAGGTAGG - Intronic
1059785261 9:117575258-117575280 TAGGTTGTAATGTCAGAGGATGG - Intergenic
1185927244 X:4161202-4161224 AAGGTGGAACTGGCAGAGGTGGG + Intergenic
1186593381 X:10954108-10954130 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1186799993 X:13083389-13083411 TAAGTTGAAATGGCAGATGAGGG + Intergenic
1187081970 X:15999781-15999803 AAGGTTGAAATCAAAGAGTTAGG + Intergenic
1187333785 X:18364328-18364350 TGGCTTAAAATGACAGAAGTTGG + Intergenic
1187472466 X:19581241-19581263 TGGCTAGAAATTACAGAGGTTGG - Intronic
1188436948 X:30171737-30171759 TAGATTGGAGAGACAGAGGTTGG - Intergenic
1188900949 X:35733018-35733040 ATGGCTGAAATGACAGAAGTAGG - Intergenic
1189581577 X:42413077-42413099 ATGGGTGAAATGACAGAAGTAGG - Intergenic
1190442828 X:50493080-50493102 TAGGTAGAAATGTAAGAGGAAGG + Intergenic
1190738385 X:53270793-53270815 GAGGTGGAGATGACAGAGGCTGG - Intronic
1190995562 X:55605509-55605531 TTTGATGAACTGACAGAGGTAGG - Intergenic
1191194690 X:57708398-57708420 TTGGATGAATTGACAGAAGTAGG + Intergenic
1191198021 X:57745273-57745295 TTGGATGAATTGACAGAAGTAGG + Intergenic
1191950089 X:66581117-66581139 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1192039545 X:67603978-67604000 TAGATTGAAATCACAGAGTTAGG + Intronic
1193351913 X:80474147-80474169 TTTGATGAATTGACAGAGGTAGG - Intergenic
1193377008 X:80773349-80773371 TAGGTTGAAATGACAGAGGTGGG - Intronic
1194002388 X:88446774-88446796 TAGCTTGAAATCACAGAAGATGG + Intergenic
1194346862 X:92775694-92775716 TAGGTTCAAAACAAAGAGGTGGG + Intergenic
1195844120 X:109208328-109208350 TTTGATGAACTGACAGAGGTAGG - Intergenic
1195969611 X:110458896-110458918 TAGTTTGAAATGACACTGGATGG + Intergenic
1196435735 X:115672737-115672759 TTTGATGAATTGACAGAGGTAGG + Intergenic
1198245039 X:134822478-134822500 TAGTGTGAAATGTCTGAGGTAGG - Intronic
1198793680 X:140373398-140373420 TAGGTTGAAATTCCAGAGTGGGG - Intergenic
1198865090 X:141113777-141113799 TAAGTTGAGAAGACAGAGCTAGG + Intergenic
1198897596 X:141473611-141473633 TAAGTTGAGAAGACAGAGCTAGG - Intergenic
1198986532 X:142460732-142460754 TAGGAGGAAGTGACAGAGGCAGG - Intergenic
1199589153 X:149450527-149450549 ATGGCTGAAATGACAGAAGTAGG - Intergenic
1200655194 Y:5892338-5892360 TAGGTTCAAAACAAAGAGGTGGG + Intergenic
1200732456 Y:6757652-6757674 TTTGTTGAATTGACAGAAGTAGG - Intergenic
1200838272 Y:7754168-7754190 TACGTTGAAATGTTAGGGGTGGG + Intergenic
1201014468 Y:9586045-9586067 TAAGTTGAGATGACAGAGCTAGG + Intergenic
1201424570 Y:13833996-13834018 CAGGATGAAATGAACGAGGTGGG + Intergenic